Inhibition of macrophage pyroptosis protects against sepsis-induced injury to the alveolar epithelial barrier
Original Article

Inhibition of macrophage pyroptosis protects against sepsis-induced injury to the alveolar epithelial barrier

Min Wang1,2, Canhua Zhang3, Chichi Li4, Dan Zhang2 ORCID logo

1Department of Nephrology, Chenggong Hospital Affiliated with Xiamen University, Xiamen, China; 2Department of Respiratory and Critical Care Medicine, The First Affiliated Hospital of Wenzhou Medical University, Wenzhou, China; 3Department of Respiratory Medicine, Zhungeerqi Central Hospital, Erdos, China; 4Department of Plastic Surgery, The First Affiliated Hospital of Wenzhou Medical University, Wenzhou, China

Contributions: (I) Conception and design: C Li, D Zhang; (II) Administrative support: None; (III) Provision of study materials or patients: None; (IV) Collection and assembly of data: M Wang, C Zhang; (V) Data analysis and interpretation: M Wang, C Zhang; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors.

Correspondence to: Chichi Li, MD, PhD. Department of Plastic Surgery, The First Affiliated Hospital of Wenzhou Medical University, Nanbaixiang, Ouhai District, Wenzhou 325000, China. Email: lichichi2008@163.com; Dan Zhang, MD, PhD. Department of Pulmonary and Critical Care Medicine, The First Affiliated Hospital of Wenzhou Medical University, Nanbaixiang, Ouhai District, Wenzhou 325000, China. Email: zhangdan6250@yeah.net.

Background: Acute lung injury (ALI) is characterized by alveolar epithelial barrier dysfunction, largely driven by excessive inflammation. This study aimed to elucidate the specific role and mechanism of macrophage pyroptosis in sepsis-induced epithelial injury.

Methods: We established an in vitro sepsis model using lipopolysaccharide (LPS)-stimulated macrophages, employing the NLRP3 inhibitor MCC950. Activation of the NLRP3 pathway and pyroptosis markers was assessed. The functional impact on the alveolar epithelial barrier was then evaluated by treating epithelial cells with conditioned medium (CM) from these macrophages. The protective effect of MCC950 was further verified in a murine model of LPS-induced septic ALI.

Results: LPS stimulation potently activated the NLRP3 inflammasome in macrophages, leading to robust pyroptosis, as indicated by a significant increase in caspase-1 activity, lactate dehydrogenase (LDH) release, and the secretion of interleukin-1 β (IL-1β) and IL-18. Pre-treatment with MCC950 completely abolished this activation. CM from LPS-activated macrophages (LPS-CM) induced severe epithelial barrier injury, manifesting as a significant increase in epithelial cell death and monolayer permeability, and a marked downregulation of tight junction proteins zonula occludens-1 (ZO-1) and occludin. Crucially, all these aforementioned effects were significantly attenuated when epithelial cells were incubated with CM from macrophages pre-treated with MCC950, demonstrating that inhibiting macrophage pyroptosis preserves epithelial barrier integrity. In vivo, MCC950 administration markedly alleviated LPS-induced lung injury, reducing pulmonary edema and alveolar-capillary barrier leakage.

Conclusions: Macrophage pyroptosis, activated via the LPS/NLRP3 pathway, is a pivotal mechanism in sepsis-induced alveolar epithelial barrier dysfunction. Pharmacological inhibition of this pathway represents a promising therapeutic strategy for ALI.

Keywords: Acute lung injury (ALI); alveolar epithelial barrier; macrophage; pyroptosis


Submitted Nov 06, 2025. Accepted for publication Jan 07, 2026. Published online Feb 25, 2026.

doi: 10.21037/jtd-2025-aw-2292


Highlight box

Key findings

• Lipopolysaccharide activates the NLRP3 inflammasome to induce pyroptosis in macrophages. This leads to the release of inflammatory factors that directly compromise the alveolar epithelial barrier, as evidenced by increased epithelial cell death, heightened monolayer permeability, and downregulation of tight junction proteins zonula occludens-1 and Occludin. Pharmacological inhibition of NLRP3 with MCC950 effectively blocks this pyroptotic cascade and protects barrier integrity in both cellular and murine models of sepsis-induced acute lung injury (ALI).

What is known and what is new?

• Dysfunction of the alveolar epithelial barrier and NLRP3-associated inflammation are known contributors to sepsis-induced ALI.

• Our study newly identified macrophage pyroptosis as the central mechanism linking systemic sepsis to this epithelial damage. We demonstrated that protection is achieved through the specific inhibition of pyroptosis in macrophages, highlighting a targeted approach distinct from broad anti-inflammatory strategies.

What is the implication, and what should change now?

• These findings established macrophage pyroptosis as a promising and precise therapeutic target for sepsis-induced ALI. Future research should focus on characterizing the complete profile of injurious mediators released by pyroptotic macrophages and validating this therapeutic strategy in more complex, pre-clinical models to facilitate clinical translation.


Introduction

Acute lung injury (ALI) and its more severe form, acute respiratory distress syndrome (ARDS), are life-threatening respiratory conditions characterized by diffuse alveolar damage (1,2). Current clinical management of sepsis-induced ALI remains largely supportive-relying on lung-protective ventilation and fluid management, and lacks specific therapies that directly target the underlying dysregulated immune response. While general anti-inflammatory strategies have been explored, their success has been limited by the complexity of the inflammatory cascade and the risk of immunosuppression, highlighting the need for more precise interventions (3).

A hallmark of ALI/ARDS is dysfunction of the alveolar epithelial barrier, driven primarily by hyperinflammation (4-6). Bacterial lipopolysaccharide (LPS), a key component of gram-negative bacterial membranes, is a major trigger of this response. Upon binding to toll-like receptor 4 (TLR4) on macrophages, LPS initiates downstream signaling that promotes the NLRP3 inflammasome activation, a critical upstream event in the pyroptotic cascade (7,8). This process is particularly relevant in macrophages, which are central to initiating and amplifying inflammatory responses in sepsis-induced ALI.

Pyroptosis, an inflammatory form of programmed cell death, exacerbates tissue injury through caspase-1-dependent release of interleukin-1 beta (IL-1β) and IL-18 (9-11). The canonical pathway often involves NLRP3 inflammasome assembly, which recruits apoptosis-associated speck-like protein containing a CARD (ASC) and activates caspase-1 (12). Although NLRP3-induced pyroptosis has been implicated in ALI (10,13), its specific role within macrophages in disrupting alveolar epithelial barrier function during sepsis remains unclear.

Based on this evidence, we hypothesized that macrophage pyroptosis critically mediates alveolar epithelial barrier dysfunction in sepsis. We investigated LPS-induced NLRP3 activation and pyroptosis in macrophages and its impact on epithelial integrity, using an NLRP3-specific inhibitor to assess the pathway’s role. Our findings aim to clarify this mechanism and reveal a targeted therapeutic strategy for sepsis-induced ALI. We present this article in accordance with the ARRIVE and MDAR reporting checklists (available at https://jtd.amegroups.com/article/view/10.21037/jtd-2025-aw-2292/rc).


Methods

Cell culture

RAW264.7 macrophages (Chinese Academy of Science, Shanghai) were cultured in DMEM (11995065, Gibco, Grand Island, NY, USA) with 10% FBS (16000044, Gibco). MLE-12 cells (American Type Culture Collection), a type of murine alveolar epithelial cell (AEC) line, were maintained in DMEM/F-12 (11320033, Gibco) containing 6% FBS and 1% penicillin/streptomycin (15140122, Gibco). All cells were kept at 37 ℃ in a 5% CO2 incubator. Cells were randomly assigned to different treatment groups.

Conditioned media (CM) preparation

RAW264.7 macrophages were treated as follows to generate CM:

  • CM1: 20 µM MCC950 (CP-456773, Sigma-Aldrich, St. Louis, MO, USA) for 2 h.
  • CM2: 1 µg/mL LPS (L2880, Sigma-Aldrich) for 12 h.
  • CM3: 20 µM MCC950 for 2 h, then 1 µg/mL LPS for 12 h.

CM was collected, centrifuged at 12,000 ×g for 15 min at 4 ℃, and diluted with DMEM/F-12 before use.

MLE-12 cell treatment

MLE-12 cells were exposed for 24 h to LPS or one of the macrophage CMs (CM1-CM3). RNA and protein were extracted for analysis of zonula occludens-1 (ZO-1) and Occludin expression. Cell permeability and viability were evaluated as below.

Cell viability assay

MLE-12 cells (1×104 cells/well) were seeded in 96-well plates. After treatment, 10 µL Cell Counting Kit-8 (CCK-8) (HY-K0301, MedChemExpress, Monmouth Junction, NJ, USA) was added per well and incubated for 2 h at 37 ℃. Absorbance at 450 nm was measured, and viability was calculated as: OD (experimental group)/OD (control group) × 100%.

Western blot

Cells were lysed in RIPA buffer with PMSF. Protein concentrations were determined by BCA assay (23225, Thermo Fisher Scientific, Waltham, MA, USA). Samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to polyvinylidene fluoride membranes, and blocked for 10 min. Membranes were incubated overnight at 4 ℃ with antibodies against NLRP3 (15101, CST, Danvers, MA, USA), caspase-1 (24232, CST), cleaved caspase-1 (E2G2I, CST), ASC (13833S, CST), GAPDH (4970S, CST), Occludin (DF7504, Affinity Biosciences, Cincinnati, OH, USA), and ZO-1 (21773-1-AP, Proteintech, Wuhan, China). After washing, membranes were incubated with horseradish peroxidase-conjugated secondary antibody (BL003A, Biosharp) for 1 h. Finally, the relative intensity of the bands was quantified by Image J software and normalized with GAPDH as the internal control.

Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted with RNAfast200 (220011, Fastagen). cDNA was synthesized using Hiscript II Q RT SuperMix (R223-01, Vazyme), and qPCR was performed with TB Green® Premix Ex Taq™ II (RR820A, Takara). Gene expression was normalized to GAPDH via the 2-△△Ct method. All samples were run in triplicate; primers are listed in Table 1.

Table 1

Primers used for RT-qPCR

Item Forward primer(5' →3') Reverse primer(5' →3')
NLRP3 GCCGTCTACGTCTTCTTCCTTTCC CATCCGCAGCCAGTGAACAGAG
Caspase-1 TGAATACAACCACTCGTACACGTCTTG CCAGATCCTCCAGCAGCAACTTC
ASC GGACGGAGTGCTGGATGCTTTG CATCTTGTCTTGGCTGGTGGTCTC
IL-1β CACTACAGGCTCCGAGATGAACAAC TGTCGTTGCTTGGTTCTCCTTGTAC
IL-18 AAGAAAGCCGCCTCAAACCTTCC TTGACGCAAGAGTCTTCTGACATGG
ZO-1 AACCCGAAACTGATGCTGTGGATAG CGCCCTTGGAATGTATGTGGAGAG
Occludin TTGGCTACGGAGGTGGCTATGG CCTTTGGCTGCTCTTGGGTCTG
GAPDH CACGGCAAATTCAACGGCACAG AGACACCAGTAGACTCCACGACATAC

RT-qPCR, reverse transcription quantitative polymerase chain reaction.

Hoechst 33342/PI staining

Macrophages were seeded in 96-well plates at 1×105 cells/mL. After 12 h of incubation, the culture medium was removed, and cells were treated as per the experimental groupings. Subsequently, the cells were stained using a Hoechst 33342/PI Double Stain Kit (CA1120, Solarbio, Beijing, China) according to the manufacturer’s protocol. Briefly, cells were washed with PBS and incubated with Hoechst 33342 (5 µg/mL) and propidium iodide (PI, 5 µg/mL) in the dark at 4 ℃ for 30 min. After washing with PBS, the stained cells were imaged using a high-content screening (HCS) system (PerkinElmer, Shelton, CT, USA). For quantification, five random fields per well were captured. The number of PI-positive cells (red fluorescence, indicating membrane rupture) and the total number of nuclei (Hoechst-positive, blue fluorescence) in each field were counted automatically using the HCS system’s built-in analysis software (Harmony, PerkinElmer). The proportion of PI-positive cells was calculated as (number of PI-positive cells/total number of nuclei) x 100% for each field, and the average from five fields was used for statistical analysis.

Lactate dehydrogenase (LDH) release assay

LDH levels in culture supernatants from macrophages or AECs were measured using an LDH assay kit (C0016, Beyotime, Shanghai, China) following the manufacturer’s protocol. Absorbance was read at 490 nm with a microplate reader. The LDH level of the control group was set as 100%, and results from other groups were normalized accordingly.

Caspase-1 activity assay

Caspase-1 activity in macrophages was measured using a commercial assay kit (C1101, Beyotime). Cells were seeded in 6-well plates and treated as indicated. After treatment, cells were collected and lysed at 4 ℃. The supernatant was collected, and protein concentration was determined using a Bradford Protein Assay Kit (P0006, Beyotime). A total of 30 µg of protein extract was incubated with the caspase-1 substrate Ac-YVAD-pNA at 37 ℃ for 2 h. The release of p-nitroaniline (pNA) was measured by absorbance at 405 nm using a microplate reader. A pNA standard curve was constructed according to the manufacturer’s protocol, and caspase-1 activity was expressed as the percentage change relative to the control group.

Enzyme-linked immunosorbent assay (ELISA)

The concentrations of IL-1β and IL-18 in macrophage culture supernatants were measured using specific ELISA kits (BP-E20533 and BP-E21213, Boyun Biotechnology, Shanghai, China) according to the manufacturer’s instructions.

LIVE/DEAD cell viability assay

Cell viability of AECs was assessed using a Calcein AM/PI Double Stain Kit (C2015M, Beyotime) following the manufacturer’s instructions. Cells were seeded in 96-well plates at 0.8×105 cells/mL and cultured for 12 h. The medium was then replaced with 100 µL of fresh medium containing LPS or macrophage CMs. After 24 h, cells were washed with PBS and co-stained with Calcein AM (2.5 µM) and PI (4.5 µM) for 30 min at 37 ℃ in the dark. Viable cells (green fluorescence from Calcein AM) were distinguished from dead cells (red fluorescence from PI) using a high-content screening system. Cell viability was quantified by analyzing five random fields per well. The software was used to count the total number of cells (Calcein AM and PI positive) and the number of viable cells (Calcein AM positive only). The percentage of viable cells was calculated as (number of viable cells / total number of cells) × 100 per field, and the average from five fields represented the value for that well.

Epithelial transwell permeability assay

AECs were seeded in the upper chambers of a transwell system (14312, LABSELECT) and treated with LPS or macrophage CMs for 24 h. Then, 100 µL of fluorescein isothiocyanate (FITC)-dextran (1 mg/mL, 40 kDa) was added to the upper chamber and incubated for 1 h to allow permeation. Subsequently, 100 µL of medium was collected from the lower compartment, and the fluorescence intensity of FITC-dextran was measured at 492/520 nm (excitation/emission) using a fluorescence microplate reader.

Cell immunofluorescence staining

Lung epithelial cells were washed with PBS and fixed with pre-warmed 4% paraformaldehyde for 30 min. After permeabilization with 0.25% Triton X-100 (Solarbio) for 10 min, cells were washed and blocked with 1% BSA for 1 h at room temperature. Subsequently, cells were incubated overnight at 4 ℃ with a ZO-1 primary antibody (1:1,000, 20742-1-AP, Proteintech), followed by a CoraLite594-conjugated goat anti-rabbit IgG secondary antibody (1:200, SA00013-4, Proteintech) for 1 h in the dark. Nuclei were stained with DAPI for 10 min. Images were acquired using an HCS system.

In vivo model of ALI and experimental group design

For the in vivo study, male wild-type BALB/c mice (aged 8–10 weeks) were purchased from the Animal Center of Wenzhou Medical University (Zhejiang, China). Experiments were performed under a project license (No. WYYY-AEC-YS-2024-0021) granted by the Animal Care and Use Committee of Wenzhou Medical University, in compliance with national guidelines for the care and use of animals (14). The mice were randomly divided into three experimental groups with six mice per group: (I) control group: mice received an intraperitoneal injection of an equivalent volume of sterile saline; (II) LPS-induced group: mice were intraperitoneally injected with LPS (10 mg/kg) to establish the septic model; (III) MCC950 treatment group (LPS + MCC950): mice were administered MCC950 (10 mg/kg) intraperitoneally twice: once 6 h prior to and once 6 h following the LPS injection. All animals were euthanized 48 h following LPS administration. A protocol was prepared before the study without registration.

Histopathological evaluation and edema assessment of lung tissue

Freshly harvested lung tissues were fixed in 10% formaldehyde, processed for paraffin embedding, and sectioned at a thickness of 4 µm. Tissue sections were stained with hematoxylin and eosin (H&E) for histological examination. A semi-quantitative lung injury score was applied by evaluating four distinct parameters: interstitial inflammation, neutrophil infiltration, congestion, and edema. Each parameter was graded on a scale from 0 to 4, defined as follows: 0, no injury; 1, injury affecting 25% of the field; 2, injury in 50%; 3, injury in 75%; and 4, diffuse injury throughout the entire field (15). For each slide, 10 randomly selected microscopic fields were evaluated. The scores from all fields were averaged to generate a final score per animal. All histopathological assessments were conducted by a pulmonary pathologist who was blinded to the experimental group assignments.

Pulmonary edema detection

To assess pulmonary edema, the wet-to-dry (W/D) weight ratio was determined. The wet weight of the lung was measured immediately after harvest. The same lung was then placed in an oven at 56 ℃ for 72 h until a constant dry weight was achieved, after which the W/D ratio was calculated.

Quantification of total protein in bronchoalveolar lavage fluid (BALF)

Following LPS challenge, the lungs were lavaged via a tracheal catheter with three sequential instillations of 0.5 mL ice-cold saline. The recovered BALF from each mouse (approximately 1.2 mL in total) was pooled and centrifuged at 4 ℃ for 15 min at 1,000 ×g. The resulting cell-free supernatant was aliquoted and stored at −80 ℃ for subsequent analysis. The total protein concentration in the BALF supernatant was determined using a commercial BCA Protein Assay Kit according to the manufacturer’s instructions.

Statistical analysis

The investigator was blinded to the group allocation during data acquisition and analysis. All data were analyzed with GraphPad Prism 8.3.0 (GraphPad Software, San Diego, CA, USA) and expressed as mean ± standard deviation (SD), and they include the results of three independent repeated experiments. Differences between the two groups were evaluated using Student’s t-test, while multiple groups were compared by one-way analysis of variance (ANOVA). Histological semiquantitative comparative analyses were performed using the nonparametric Mann-Whitney test. A P value <0.05 was considered statistically significant.


Results

The cytotoxicity of MCC950 or LPS on macrophages

To evaluate the potential cytotoxicity of LPS or MCC950 on macrophages, the cells were treated with increasing concentrations of MCC950 (0, 10, 20, 40, 50, and 100 µM) or LPS (0, 0.01, 0.1, 1, and 10 µg/mL) for 12 h. According to the CCK-8 assay, LPS did not induce significant cytotoxicity at concentrations up to 10 µg/mL after 12 h of treatment (Figure 1A). Since cell viability was optimal at 1 µg/mL LPS, this concentration was selected for subsequent experiments. Similarly, MCC950 showed no notable cytotoxic effects at concentrations up to 40 µM (Figure 1B). Therefore, a concentration of 20 µM MCC950 was used in the following studies.

Figure 1 Effects of LPS and MCC950 on macrophage viability. (A) Macrophage viability after 12 h treatment with the indicated concentrations of LPS. (B) Macrophage viability after 12 h treatment with the indicated concentrations of MCC950. Viability was assessed using the CCK-8 assay. Data are presented as the mean ± standard deviation of three independent experiments. **, P<0.01 compared to the control group. CCK-8, Cell Counting Kit-8; LPS, lipopolysaccharide.

MCC950 suppressed LPS-induced macrophage pyroptosis

To evaluate the level of macrophage pyroptosis, we measured the expression of NLRP3 inflammasome-related components and the cytokines IL-1β and IL-18 at both mRNA and protein levels. As shown in Figure 2A-2C, LPS significantly increased the mRNA expression of NLRP3, ASC, and caspase-1, whereas MCC950 preconditioning reduced these levels. Similarly, LPS markedly upregulated the mRNA expression of IL-1β and IL-18, which was also attenuated by MCC950 pretreatment (Figure 2D,2E). In another experiment, we assessed caspase-1 activity, which is recruited upon NLRP3 activation to cleave pro-IL-1β and pro-IL-18 into their mature forms. LPS stimulation significantly enhanced caspase-1 activity, and this effect was markedly inhibited by MCC950 pretreatment (Figure 2F). At the protein level, LPS-induced upregulation of NLRP3, ASC, and caspase-1 protein levels was similarly suppressed by MCC950 (Figure 2G-2J).

Figure 2 MCC950 inhibits LPS-induced macrophage pyroptosis. Macrophages were pretreated for 2 h with MCC950 (20 µM), followed by stimulation with 1 µg/mL LPS for 12 h. (A-E) RT-qPCR analysis of mRNA expression levels for NLRP3, caspase-1, ASC, IL-1β, and IL-18. (F) Caspase-1 activity was measured using a specific activity assay. (G-J) Protein levels of NLRP3, caspase-1 and cleaved caspase-1, and ASC, were assessed by Western blotting. (K,L) ELISA was used to quantify the concentrations of IL-1β and IL-18 in the culture supernatant (n=9). Data are presented as mean ± standard deviation. *, P<0.05; **, P<0.01. ASC, apoptosis-associated speck-like protein containing a CARD; ELISA, enzyme-linked immunosorbent assay; LPS, lipopolysaccharide; RT-qPCR, reverse transcription quantitative polymerase chain reaction.

Furthermore, LPS increased the concentrations of IL-1β and IL-18 in the macrophage culture supernatant, and these increases were significantly reduced by MCC950 (Figure 2K,2L). Taken together, these results indicate that MCC950 suppresses LPS-induced pyroptosis in macrophages.

Effects of pyroptosis on cell membrane integrity in LPS-treated macrophages

Cell membrane integrity was assessed using Hoechst 33342 and propidium iodide (PI) double staining. The ratio of membrane-damaged cells (PI-positive, red) to total cells (Hoechst-positive, blue) was quantified. As shown in Figure 3A,3B, LPS treatment significantly increased the percentage of PI-positive cells, an effect that was effectively reduced by MCC950 preconditioning.

Figure 3 Inhibition of pyroptosis partially restores cellular membrane integrity in LPS-treated macrophages. (A) Representative fluorescence micrographs of macrophages stained with Hoechst 33342 (blue, nuclei) and PI (red, membrane-impermeant dye). Images from both channels are merged. Scale bar: 100 µm. (B) Quantification of membrane-damaged cells, presented as the percentage of PI-positive cells relative to the total number of Hoechst 33342-positive nuclei. (C) Measurement of LDH release in the culture supernatant. MCC950 treatment significantly attenuated LPS-induced LDH release. All data are presented as the mean ± standard deviation from three independent experiments. *, P<0.05; **, P<0.01. LDH, lactate dehydrogenase; LPS, lipopolysaccharide; PI, propidium iodide.

LDH is a well-established indicator of loss of cell membrane integrity. During pyroptosis, LDH and proinflammatory cytokines can be released through nonselective pores formed by the N-terminal fragment of Gasdermin D (GSDMD-N) in the cell membrane. As shown in Figure 3C, LPS stimulation significantly promoted LDH release, which was markedly suppressed by MCC950 pretreatment.

Collectively, these results indicate that MCC950 attenuates LPS-induced pyroptosis and helps preserve macrophage membrane integrity.

Macrophage pyroptosis promotes AEC injury and barrier dysfunction under LPS treatment

Excessive inflammatory cytokines can contribute to lung epithelial cell injury and increased permeability. To investigate the role of macrophage pyroptosis in alveolar epithelial barrier function, we cultured AECs with CM from different macrophage groups: CM1 (from macrophages under physiological conditions), CM2 (from LPS-treated macrophages), and CM3 (from macrophages pretreated with MCC950 before LPS exposure).

AEC viability was assessed using the fluorescent probes Calcein-AM and PI, which distinguish live from dead cells. Neither direct LPS stimulation nor CM1 incubation significantly affected AEC survival. However, compared with CM1, incubation with CM2 led to a significant reduction in the number of live cells. This decrease was largely reversed in the CM3 group, where cell survival was significantly higher than in the CM2 group (Figure 4A,4B).

Figure 4 Macrophage pyroptosis promotes alveolar epithelial cell injury and increases barrier permeability. (A) Representative fluorescence micrographs of alveolar epithelial cells co-stained with Calcein-AM (green, indicating viable cells) and PI (red, indicating dead cells). Scale bar: 100 µm. (B) Quantitative analysis of the percentage of viable cells (Calcein-AM-positive). (C) Measurement of LDH release as an indicator of cellular injury. (D) Evaluation of alveolar epithelial barrier permeability using a transwell permeability assay. Data are presented as the mean ± standard deviation from three independent experiments. ns, not significant; **, P<0.01; ***, P<0.001. CM, conditioned medium; LDH, lactate dehydrogenase; LPS, lipopolysaccharide; PI, propidium iodide.

LDH release, a marker of cell membrane damage, showed a similar trend: neither LPS nor CM1 induced significant LDH release, whereas CM2 induced substantial LDH release compared to CM1. This effect was significantly attenuated in the CM3 group (Figure 4C).

We also evaluated alveolar epithelial permeability using FITC-dextran translocation. LPS stimulation alone or CM1 incubation had no significant effect on permeability. In contrast, CM2 markedly increased epithelial permeability compared to CM1, and this increase was significantly reduced in the CM3 group (Figure 4D).

These findings suggest that pyroptosis activation in macrophages promotes the release of inflammatory factors, leading to AEC injury and loss of barrier integrity.

Macrophage pyroptosis downregulates tight junction (TJ)-related protein expression in AECs

TJs play a critical role in maintaining alveolar epithelial barrier function. ZO-1 and Occludin are key protein components of these junctions. In this study, we evaluated the expression of ZO-1 and Occludin to assess alveolar epithelial barrier integrity. As shown in Figure 5A-5E, neither direct LPS stimulation nor incubation with CM1 significantly altered the expression of ZO-1 or Occludin. However, compared with the CM1 group, CM2 incubation led to a marked decrease in the expression of both proteins. In contrast, these levels were significantly restored in the CM3 group relative to the CM2 group.

Figure 5 Effects of macrophage pyroptosis on tight junction protein expression in alveolar epithelial cells. (A-C) Protein levels of ZO-1 and occludin were assessed by Western blot. (D,E) mRNA levels of occludin and ZO-1 were measured by RT-qPCR and normalized to GAPDH. (F) Representative immunofluorescence images showing ZO-1 (red) in lung epithelial cells. Nuclei were counterstained with DAPI (blue). Arrows indicate ZO-1 expression. Scale bar: 100 µm. Lower panels are magnified views of the boxed regions (10× magnification). Data are presented as mean ± standard deviation from three independent experiments. ns, not significant; *, P<0.05; **, P<0.01; ***, P<0.001. CM, conditioned medium; LPS, lipopolysaccharide; RT-qPCR, reverse transcription quantitative polymerase chain reaction; ZO-1, zonula occludens-1.

We further examined the expression and localization of ZO-1 by immunofluorescence staining. As illustrated in Figure 5F, neither LPS stimulation nor CM1 incubation disrupted ZO-1 expression or distribution, which displayed a continuous, circular pattern around the nucleus. In contrast, CM2 incubation significantly reduced ZO-1 expression and resulted in irregular, fragmented ZO-1 staining. These disruptions were largely reversed in the CM3 group, where ZO-1 staining appeared more continuous and linear, resembling the pattern observed in the control group.

MCC950 pretreatment protected against LPS-induced lung injury

To evaluate the effect of the pyroptosis inhibitor MCC950 on alveolar-capillary membrane barrier integrity, a murine model of septic lung injury was established. Histopathological analysis was performed to assess the effects of MCC950 on septic lung injury. Compared with controls, lung tissues from LPS-injured mice exhibited more severe edema, leukocyte infiltration, and hemorrhage. These pathological changes were substantially alleviated by MCC950 treatment (Figure 6A). Consistent with the morphological observations, the lung injury score was significantly higher in the LPS group than in the control group, and MCC950 treatment notably reduced this score (Figure 6B).

Figure 6 MCC950 pretreatment ameliorates LPS-induced lung injury in mice. (A) Representative photomicrographs of lung tissue sections (hematoxylin and eosin staining, magnification: 200×) from the indicated experimental groups. (B) Quantitative assessment of lung injury severity using the lung injury score. (C) Evaluation of pulmonary edema by measuring the lung wet/dry weight ratio. (D) Assessment of alveolar-capillary membrane permeability based on the total protein concentration in BALF. Data are presented as mean ± standard deviation. ****, P<0.0001. BALF, bronchoalveolar lavage fluid; LPS, lipopolysaccharide.

The extent of pulmonary edema and damage to the alveolar-capillary barrier was further assessed by measuring the lung wet/dry weight ratio. LPS challenge significantly increased the lung W/D ratio compared with the control group, while MCC950 treatment significantly attenuated this increase (Figure 6C).

The total protein concentration in BALF, another indicator of alveolar-capillary membrane permeability, was also examined. LPS-induced lung injury resulted in a significant rise in BALF protein concentration relative to controls, which was markedly reduced by MCC950 administration (Figure 6D).

Together, these results indicate that macrophage pyroptosis contributes to the downregulation of TJ proteins in AECs and that inhibition of pyroptosis helps preserve epithelial barrier integrity.


Discussion

This study demonstrates the critical role of macrophage pyroptosis in disrupting the alveolar epithelial barrier during LPS challenge. Our in vitro findings show that LPS triggers NLRP3 inflammasome-mediated pyroptosis in macrophages, a process effectively inhibited by MCC950. CM from pyroptotic macrophages, but not from MCC950-pretreated cells, induced AEC injury, increased permeability, and downregulated TJ proteins ZO-1 and Occludin. Importantly, these core findings were corroborated in our in vivo sepsis-induced ALI model, where MCC950 administration similarly attenuated lung injury and helped preserve alveolar barrier integrity, confirming the translational relevance of the pathway identified in vitro.

Pyroptosis is a defensive mechanism that can become detrimental upon excessive activation, releasing a flood of inflammatory mediators (16-18). Macrophages are key players, with LPS activating the canonical TLR4/NLRP3/caspase-1/GSDMD pathway (19,20). Our data confirmed LPS-induced NLRP3 activation, IL-1β/IL-18 maturation, and lytic cell death in macrophages, all suppressed by MCC950. This directly addresses a key question: MCC950’s protection stems from blocking both pyroptosis and the subsequent release of injurious mediators. While IL-1β and IL-18 are elevated, the CM is a complex mix of factors. Prior work shows cytokines like TNF-α, IFN-γ, and IL-1β disrupt TJs (21,22). Thus, epithelial damage likely results from a synergistic combination of released factors, not IL-1β/IL-18 alone. Future studies using neutralizing antibodies or proteomic analysis of CM derived from alveolar macrophages in vivo are needed to identify the principal effector molecules and delineate the precise mechanistic chain.

Epithelial barrier failure is central to ALI. We found that CM from pyroptotic macrophages, but not LPS alone, drove AEC damage and barrier loss, pinpointing pyroptosis as the key driver. This central role implies that inhibiting pyroptosis could preserve barrier integrity and potentially enhance endogenous repair by mitigating inflammation. By reducing cytotoxic mediators, MCC950 may prevent secondary epithelial apoptosis and foster a pro-repair microenvironment. Exploring the effect of pyroptosis inhibition on specific epithelial repair mechanisms in vivo, such as proliferation and migration, is a valuable future direction, as suggested.

TJ proteins like ZO-1 and Occludin are vital for barrier integrity. Inflammatory responses disrupt their expression and localization (23). Consistent with this, CM from pyroptotic macrophages downregulated ZO-1 and Occludin and disrupted ZO-1 distribution, effects reversed by MCC950. Our in vivo observations aligned, showing MCC950 helped maintain air-blood barrier integrity in injured lung tissue. This strongly suggests that pyroptosis-related mediators disrupt TJs. As discussed, these likely include IL-1β and IL-18. Verifying their individual and combined roles, along with their downstream effectors in epithelial cells, remains a necessary next step to deepen the mechanistic understanding.

This study has limitations. While the consistent conclusions from our in vitro and in vivo experiments strengthen our findings, they may not fully capture the complexity of human sepsis. Furthermore, as noted, the precise damaging factors within the CM and their downstream molecular effectors require further elucidation. Additionally, future work should employ co-culture or more complex models to dissect the crosstalk between epithelial, endothelial, and immune cells within the alveolar niche.


Conclusions

In conclusion, our study demonstrates that LPS-induced activation of the NLRP3 inflammasome in macrophages is a key driver of pyroptosis, contributing to the hyperinflammatory response in sepsis-associated ALI. Inhibiting this process with MCC950 mitigated AEC death and barrier disruption, in part by preserving TJ integrity. These findings highlight the therapeutic potential of targeting macrophage pyroptosis to control excessive inflammation and ameliorate sepsis-induced ALI.


Acknowledgments

None.


Footnote

Reporting Checklist: The authors have completed the ARRIVE and MDAR reporting checklists. Available at https://jtd.amegroups.com/article/view/10.21037/jtd-2025-aw-2292/rc

Data Sharing Statement: Available at https://jtd.amegroups.com/article/view/10.21037/jtd-2025-aw-2292/dss

Peer Review File: Available at https://jtd.amegroups.com/article/view/10.21037/jtd-2025-aw-2292/prf

Funding: This work was supported by the Zhejiang Provincial Natural Science Foundation of China Grant (Nos. LMS25H010004 and LY23H150002), and the Project for Improving the Technological Innovation Environment in Zhungeer Banner of China Grant (No. 2024HJ-03).

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://jtd.amegroups.com/article/view/10.21037/jtd-2025-aw-2292/coif). The authors have no conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. Experiments were performed under a project license (No. WYYY-AEC-YS-2024-0021) granted by the Animal Care and Use Committee of Wenzhou Medical University, in compliance with national guidelines for the care and use of animals.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.


References

  1. Matthay MA, Arabi Y, Arroliga AC, et al. A New Global Definition of Acute Respiratory Distress Syndrome. Am J Respir Crit Care Med 2024;209:37-47. [Crossref] [PubMed]
  2. Biuzzi C, Modica E, De Filippis N, et al. Old and New Definitions of Acute Respiratory Distress Syndrome (ARDS): An Overview of Practical Considerations and Clinical Implications. Diagnostics (Basel) 2025;15:1930. [Crossref] [PubMed]
  3. Bos LDJ, Ware LB. Acute respiratory distress syndrome: causes, pathophysiology, and phenotypes. Lancet 2022;400:1145-56. [Crossref] [PubMed]
  4. Wang J, Chao J. Alveolar Epithelial Cell Dysfunction in Acute Respiratory Distress Syndrome: Mechanistic Insights and Targeted Interventions. Biomedicines 2025;13:2299. [Crossref] [PubMed]
  5. Tao H, Xu Y, Zhang S. The Role of Macrophages and Alveolar Epithelial Cells in the Development of ARDS. Inflammation 2023;46:47-55. [Crossref] [PubMed]
  6. Jia G, Song E, Zheng Z, et al. Alveolar epithelial cells in bacterial sepsis-associated acute lung injury: mechanisms and therapeutic strategies. Front Immunol 2025;16:1605797. [Crossref] [PubMed]
  7. Dubey SR, Turnbull C, Pandey A, et al. Molecular mechanisms and regulation of inflammasome activation and signaling: sensing of pathogens and damage molecular patterns. Cell Mol Immunol 2025;22:1313-44. [Crossref] [PubMed]
  8. Luo R, Yao Y, Chen Z, et al. An examination of the LPS-TLR4 immune response through the analysis of molecular structures and protein-protein interactions. Cell Commun Signal 2025;23:142. [Crossref] [PubMed]
  9. Liu Y, Pan R, Ouyang Y, et al. Pyroptosis in health and disease: mechanisms, regulation and clinical perspective. Signal Transduct Target Ther 2024;9:245. [Crossref] [PubMed]
  10. Liu B, He R, Zhang L, et al. Inflammatory Caspases Drive Pyroptosis in Acute Lung Injury. Front Pharmacol 2021;12:631256. [Crossref] [PubMed]
  11. Ai Y, Meng Y, Yan B, et al. The biochemical pathways of apoptotic, necroptotic, pyroptotic, and ferroptotic cell death. Mol Cell 2024;84:170-9. [Crossref] [PubMed]
  12. Paik S, Kim JK, Shin HJ, et al. Updated insights into the molecular networks for NLRP3 inflammasome activation. Cell Mol Immunol 2025;22:563-96. [Crossref] [PubMed]
  13. Wei T, Zhang C, Song Y. Molecular mechanisms and roles of pyroptosis in acute lung injury. Chin Med J (Engl) 2022;135:2417-26. [Crossref] [PubMed]
  14. National Research Council (US) Committee for the Update of the Guide for the Care and Use of Laboratory Animals. Guide for the Care and Use of Laboratory Animals. 8th ed. Washington (DC): National Academies Press (US); 2011.
  15. Predella C, Iezza D, Miller ML, et al. Standardized Digital Method for Histological Evaluation of Experimental Acute Lung Injury. Am J Respir Cell Mol Biol 2023;69:596-8. [Crossref] [PubMed]
  16. He C, Zhao Y, Jiang X, et al. Protective effect of Ketone musk on LPS/ATP-induced pyroptosis in J774A.1 cells through suppressing NLRP3/GSDMD pathway. Int Immunopharmacol 2019;71:328-35. [Crossref] [PubMed]
  17. Lv X, Fan C, Jiang Z, et al. Isoliquiritigenin alleviates P. gingivalis-LPS/ATP-induced pyroptosis by inhibiting NF-κB/ NLRP3/GSDMD signals in human gingival fibroblasts. Int Immunopharmacol 2021;101:108338. [Crossref] [PubMed]
  18. Wei Y, Yang L, Pandeya A, et al. Pyroptosis-Induced Inflammation and Tissue Damage. J Mol Biol 2022;434:167301. [Crossref] [PubMed]
  19. Cai Y, Shang L, Zhou F, et al. Macrophage pyroptosis and its crucial role in ALI/ARDS. Front Immunol 2025;16:1530849. [Crossref] [PubMed]
  20. Jiang R, Xu J, Zhang Y, et al. Ligustrazine Alleviate Acute Lung Injury Through Suppressing Pyroptosis and Apoptosis of Alveolar Macrophages. Front Pharmacol 2021;12:680512. [Crossref] [PubMed]
  21. Ng CT, Fong LY, Tan JJ, et al. Endothelial barrier disruptive effect of IFN-Ƴ and TNF-α: Synergism of pro-inflammatory cytokines. Cytokine. Cytokine 2025;190:156922. [Crossref] [PubMed]
  22. Colás-Algora N, Muñoz-Pinillos P, Cacho-Navas C, et al. Simultaneous Targeting of IL-1-Signaling and IL-6-Trans-Signaling Preserves Human Pulmonary Endothelial Barrier Function During a Cytokine Storm-Brief Report. Arterioscler Thromb Vasc Biol 2023;43:2213-22. [Crossref] [PubMed]
  23. Godbole NM, Chowdhury AA, Chataut N, et al. Tight Junctions, the Epithelial Barrier, and Toll-like Receptor-4 During Lung Injury. Inflammation 2022;45:2142-62. [Crossref] [PubMed]
Cite this article as: Wang M, Zhang C, Li C, Zhang D. Inhibition of macrophage pyroptosis protects against sepsis-induced injury to the alveolar epithelial barrier. J Thorac Dis 2026;18(2):57. doi: 10.21037/jtd-2025-aw-2292

Download Citation