17-hydroxy-jolkinolide B potentiated CTLA4ab therapy through targeting tumor suppression and immune activation by downregulating PD-L1 expression in lung adenocarcinoma
Highlight box
Key findings
• Our study revealed that 17-hydroxy-jolkinolide B (HJB) potentiated cytotoxic T-lymphocyte antigen 4 antibody (CTLA4ab) therapy by inhibiting proliferation, migration, and tumorigenicity in lung adenocarcinoma (LUAD) and promoting immune activation by reducing programmed death ligand 1 (PD-L1) expression in vitro and in vivo.
What is known and what is new?
• HJB induced apoptosis by targeting the signal transducer and activator of transcription 3 (STAT3) and inactivating the mTOR pathway, thereby inhibiting cell growth and angiogenesis. STAT3 is a transcription factor known to modulate the vital immune checkpoint protein PD-L1 expression and participate in immune escape.
• Our study revealed that HJB inhibited the proliferation, migration, and tumorigenicity of LUAD and potentiated CTLA4ab immune checkpoint blockades (ICBs) therapy by modulating the STAT3/PD-L1 pathway in vitro and in vivo.
What is the implication, and what should change now?
• Our results provided a theoretical basis for HJB’s anti-tumor activity and preliminary described its mechanism of action and its enhanced effect on ICBs therapy. Furthermore, it may help to determine HJB as a potential drug or provide a powerful leading compound structure in LUAD therapy. However, further exploration is warranted to determine whether HJB can be applied to the treatment of LUAD in clinical practice.
Introduction
Lung cancer displays one of the highest incidences and mortality, with a 5-year survival rate of only 10–20% (1). Among the diagnosed cases, lung adenocarcinoma (LUAD) is the most common histological subtype, accounting for ~40% of cases (2). Conventional therapy such as radical resection with lobectomy or segmentectomy is typically effective in LUAD, but these therapeutic options are limited to patients in the early stage, with advanced LUAD having a poor prognosis (3). Chemotherapy and radiation remain first-line therapies, but their toxic side effects should not be overlooked (4). Due to its long-lasting effects and low toxicity, immunotherapy has emerged as a promising treatment option that targets immune checkpoints using agents such as programmed death ligand 1 (PD-L1) antibodies and programmed cell death protein 1 (PD-1) (5,6). Nonetheless, some patients show low response to immune checkpoint inhibitors (ICIs), which may be attributed to the immunosuppressive tumor microenvironment (TME), where tumor cells prevent immune CD8+ T cell infiltration, resulting in low treatment efficiency (7,8). Only a small portion of advanced LUAD patients can benefit from this treatment modality (9). Therefore, strategies should be developed to enhance immune checkpoint blockades (ICBs) such as cytotoxic T-lymphocyte antigen 4 antibody therapy (CTLA4ab) and expand the benefits of immunotherapy to low-response LUAD patients.
Multiple natural products have been shown to exert therapeutic effects against many diseases, such as bacterial infections, diabetes, and cancer (10-13). In anticancer research, about 70% of marketed anticancer drugs are derived from natural products or related derivatives (14). There are many studies about natural product exerting anti-tumor effect, such as curcumin significantly inhibited the proliferation, migration, and invasion of LUAD cells (15), and hypocrellin B inhibited LUAD cell growth (16), etc. However, most previous studies about natural products focused on direct inhibition of LUAD cells. In other words, studies on its modulating effect on TME especially tumor immune microenvironment are relatively scarce. Recently, a growing number of diterpenoids derived from the Euphorbiaceae family have been shown to exert anticancer activity and are candidates in cancer drug development (17-19). As one such member, 17-hydroxy-jolkinolide B (HJB), a promising natural diterpenoid isolated from plants of the Euphorbiaceae family, demonstrated anticancer effects in breast cancer (20), leukemia (21), colorectal cancer (22), and gastric cancer (23) in vitro and in vivo. Nonetheless, its anticancer properties against lung cancer remain poorly understood and previous research mostly focused on directly inhibiting cancer cells through the NF-κB or mTOR signaling pathway (24,25). The potential effect of HJB on the immune aspect of the TME has not been reported.
Previous studies have reported that HJB induced apoptosis by targeting the signal transducer and activator of transcription 3 (STAT3) and inactivating the mTOR pathway, thereby inhibiting cell growth and angiogenesis (21,24,26). STAT3 is a transcription factor known to modulate the vital immune checkpoint protein PD-L1 expression and participate in immune escape (27,28). Besides, research has revealed that PD-L1 is widely expressed in tumor cells and mediates cell growth in various cancers, especially in lung cancer (29-31). Hence, this study determined whether HJB directly inhibited LUAD progression and participated in modulating the tumor immune microenvironment.
This study aimed to explore the possible direct anticancer effects and related mechanisms of HJB on LUAD in vitro and in vivo. Furthermore, the functional role of HJB in the immune microenvironment and in CTLA4ab therapy was investigated. We present this article in accordance with the ARRIVE and MDAR reporting checklists (available at https://jtd.amegroups.com/article/view/10.21037/jtd-24-781/rc).
Methods
Cell culture and reagents
The LUAD cell lines Lewis, and normal lung fibroblast cells MRC-5 were purchased from Cellcook (Cat#CC9044 and Cat#CC4010, Guangzhou, China). The common-used LUAD cell lines HCC827, H2228, and normal lung fibroblast cells WI38 were obtained from Procell (Cat#CL-0094, Cat#CL-0570, Cat#CM-0466, Wuhan, China) which have passed the STR verification and mycoplasma test by MycAwayTM Mycoplasma Real-time qPCR Detection Kit from YeSen (Cat#40618ES25, Shanghai, China). WI-38 and MRC-5 were grown in Eagle’s Minimum Essential Medium (MEM, Gibco, Waltham, MA, USA), whereas HCC827 and H2228 were cultured in Roswell Park Memorial Institute-1640 (RPMI-1640, Gibco). Lewis was maintained in dulbecco’s modified eagle medium (DMEM, Gibco). All the above-cultured media were added with 10% fetal bovine serum (FBS, Gibco), penicillin-streptomycin (100 IU/mL and 100 µg/mL, Solarbio, China) at 37 ℃ with 5% CO2.
In vitro cytotoxicity assays
The cytotoxic effects of HJB (Cat#B23527, Yuanye, Shanghai, China) on human and murine LUAD cell lines were tested by Cell Counting Kit-8 (CCK-8) assay and colony formation assay. For the CCK-8 assay, H2228 and HCC827 were digested and the cell number was counted. Cells were then transferred to the medium containing 10% FBS with different concentrations of HJB (0, 10, 50, 100 µM). The cells were seeded in a 96-well plate at a density of 1×103 cells/well and cultured at 37 ℃ overnight. On day 2, cell viability was measured by employing CCK-8 kits (Dojindo, Kumamoto, Japan). The incubation time of the CCK-8 kits with cells was 2 h. Subsequently, the optical density (OD) value was measured by a microplate reader (Bio-Rad Laboratories Inc, USA) at 450 nm.
In the colony formation assay, approximately 400 targeted cells were digested and seeded into a 6-well plate and cultured at 37 ℃ overnight. After 24 h, the pure medium was replaced by the treatment medium mixed with HJB (0, 50 µM). The cells were cultured for 12–14 days and then subjected to fixation using methyl alcohol and staining with Giemsa dye. The 6-well plates were dried and photographed. The number of cell colonies was counted by Image J. The experiment was tested with three replicates.
Scratch wound-healing assay
HCC827 cells were initially seeded into a 6-well plate at a density of 1×106 cells/well. After 1–2 days of culture in an incubator, the cells grew into a monolayer. A scratch was made utilizing pipette tips. The pure medium was replaced by the treatment medium mixed with HJB (0, 50 µM). Finally, cell migration was determined by imaging at 0,12, 24 and 36 h using an inverted microscope (Zeiss, Axio Observer A1, Germany). The experiment was tested with three replicates.
In vivo antitumor activity
The in vivo antitumor activities of HJB were evaluated by establishing HCC827 and H2228 xenograft tumor models and a murine Lewis tumor model. In the xenograft tumor models, the mice (BALB/C nude mice, female, 4 weeks old, Cat#Z20230911, Zhiyuan Biomedical Technology Co., LTD., Guangzhou, China) were inoculated with HCC827 and H2228 cells at a density of 1×106 cells per mouse for 6–7 days. When the tumor volume reached 50–100 mm3 (the formula for volume was length × width2/2), the tumor-bearing mice were randomly distributed into two groups (n=6) and received the treatment [HJB, 5 mg/kg/2 days, intraperitoneally (i.p.)]. In the syngeneic mouse LUAD model, Lewis cells at a density of 5×105 cells per mouse were grafted on the C57BL/6 mice (5–6 weeks old, female, Cat#Z20230911, Zhiyuan Biomedical Technology Co., LTD.) for 6–7 days, which were randomly divided into four groups, including the control group, HJB group, CTLA4ab group, and HJB+ CTLA4ab group, n=7). The mice received the corresponding treatment (HJB, 5 mg/kg/2 days, i.p.); CTLA4ab, 200 µg/per mouse/2 days, i.p. Bioxcell, Neobioscience, China). The basis for selecting the dosage of HJB in this study is referring to a recent report. The report indicated that HJB (5 mg/kg, i.p.) markedly reduced breast tumor growth and metastasis. Furthermore, this dosage of HJB showed little toxicity to the mice (32). Body weights and tumor volumes were recorded every other day. On days 15–17, when the tumor reached approximately 1,000 mm3, the mice were euthanized, and tumors were harvested. Tumor weights were recorded and photographed to further assess the antitumor efficiency. Tissue sections were prepared for staining after fixation in formalin for at least 48 h. The experiment was tested with two replicates.
Quantitative real-time polymerase chain reaction array assay (qPCR)
The mRNA expression of STAT3 or PD-L1 was assessed using the qPCR method. Briefly, the LUAD cells were collected and total RNAs were extracted utilizing TRIzol (Invitrogen, Carlsbad, CA, USA). Prime-Script RT reagent Kit (Promega, Madison, WI, USA) was used to transform the collected RNA into cDNA. Finally, the qPCR assay was performed with SYBR Premix EX TaqTM (TAKARA, Dalian, China) and an ABI 7500 Real-Time PCR system (Applied Bio-systems, Foster City, CA, USA) was employed to perform the DNA amplification reactions and collect the value indicating cycles of threshold (CT value, CT = −1/lg(1+Ex)*lgX₀+lgN/lg(1+Ex), X₀ represented the initial template amount, Ex represented the amplification efficiency, and N represented the amount of amplified product when the fluorescence amplification signal reached the threshold). After checking out melting curve and assuring that only a single peak was present, we analyzed the relative expression utilizing the formula as follows: (I) ∆CT(n) = CT (target gene) − CT (internal reference gene); (II) ∆∆CT(n) = ∆CT(n) − ∆CT(1). (III) Relative expression= 2−∆∆CT; n represented the number of cycles of amplification reaction. The primer sequences of STAT3 were as follows: forward primer, TCATTCACCGGGCTCTCTAC T; reverse primer, GAGAGCCCGGT GAATGATGG. The primer sequences of PD-L1 (Human): forward primer, GGACAAGCAGTGA CCATCAAG; reverse primer, CCCAGAATTA CCAAGTGAGTCCT. The primer sequences of PD-L1 (Mouse): forward primer, GCTCCAAAGGACTTGTACGTG; reverse primer, TGATCT GAAGGGCAGCATTTC. The primer sequences of GAPDH (Mouse) were: forward primer, AGGTCGGTGTGAACGGATTTG; reverse primer, TGTAGACCATGT AGTTGAGGTCA. The primer sequences of GAPDH (Human) were: forward primer, GGAGCGAGATCCCTCCAAAAT; reverse primer, GGCTGTTGTCATACTT CTCATGG. The experiment was tested with three replicates.
Cell transfection
Opti-MEM (FBS, Gibco) and Lipofectamine 2000 (Invitrogen) were mainly utilized to transfer the siRNA targeted STAT3 (SiSTAT3, sequence: GCTGACCAACAATCCCAAGAA) and PD-L1 (SiSTAT3, sequence: CGAATTACTGTGAAAGTCAAT) which was purchased from Genechem (Shanghai, China), into human LUAD cells according to the manufacturer’s instructions. After 48 h, the LUAD cells were collected for detection or prepared for the following in vitro assay. The short hairpin RNA (shRNA) targeted PD-L1 in murine LUAD cells was synthesized by Geneseed (Guangzhou, China) with the sequence CCGAAATGATACACAATTCGA. Package tool cell line HEK293T was transferred into targeted shRNA utilizing Lipofectamine 2000 and Opti-MEM. Then, the supernatant containing the recombinant lentiviruses was collected and transfected with the targeted LUAD cells. The transfected LUAD cells were screened for 10 days with 0.6 mg/mL puromycin. The efficiency of transfection was determined by qPCR and the transfected cells were prepared for the following experiments.
Western blotting (WB) analysis
The protein of treated cells was collected and separated by SDS-polyacrylamide gel electrophoresis (PAGE). The targeted area was cut and electro transferred onto a polyvinyl Dene difluoride (PVDF) membrane. After being blocked with skimmed milk (5%), the membranes were incubated utilizing primary antibodies against PD-L1 (1:1,000, Cat#14-5983-80, Invitrogen) and against GAPDH (1:1,000, Cat#TA-08, ZSbio, Beijing, China) overnight. The experiment was tested with three replicates.
Immunohistochemistry (IHC)
The harvested tumor tissues were first fixed in 10% neutral buffered formalin for a least 3 days. After dehydration and encapsulation, the tissues were excised into sections. The sections were baked, dewaxed, and placed in citrate for antigen retrieval. Hydrogen peroxide at 3% was then used to incubate with the sections to reduce the endogenous peroxidase activity. After incubating with primary antibodies against CD8 (1:1,000, Cat# ab209775, Abcam, USA) and staining with 3,3-diaminobenzi-dine (DAB) and Mayer’s hematoxylin, the sections were imaged and the number of positive cells was counted. The experiment was tested with two replicates.
Statistical analysis
All data from three independent experiments were subjected to statistical analysis and presented as mean ± standard deviation (SD). A Student’s t-test or two-way ANOVA was utilized to examine the statistical significance compared with the control group. In this study, P<0.05 was considered statistically significant, which was presented as follows: ns, non-significant; *, P<0.05; **, P<0.01; ***, P<0.001.
Ethical statement
All experiments were performed in accordance with the ethical standards of The First Affiliated Hospital of Guangzhou Medical University and the Declaration of Helsinki (as revised in 2013). All animal experiments were approved by the Animal Care and Use Committee of The First Affiliated Hospital of Guangzhou Medical University and complied with the guidelines for the ethical treatment of animals (approval No. 20240413).
Results
HJB impeded proliferation, colony formation, and migration of LUAD cells in vitro
To investigate the effects of HJB (Figure 1A) on LUAD cell progression, the proliferation, colony-forming, and migration properties were evaluated using a CCK-8 assay, colony formation assay, and scratch wound-healing assay, respectively. As illustrated in Figure 1B-1D, the murine LUAD cell line Lewis and human LUAD cell lines H2228 and HCC827 were treated with 10, 50, 100 µM HJB for 96 h. HJB displayed a concentration-dependent inhibition on cell viability. The colony formation assay results indicated that HJB significantly reduced the number of cell colonies in human LUAD cell lines H2228 and HCC827 (Figure 1E,1F). Furthermore, the scratch wound-healing assay revealed that HJB hampered the movement of human LUAD cells H2228 (Figure 1G,1H) and HCC827 (Figure 1I,1J). Collectively, these findings indicated that HJB suppressed LUAD progression by inhibiting the proliferation, colony-formation, and migration ability of murine and human LUAD cells in vitro.
HJB suppressed syngeneic and xenograft tumor growth in vivo
In vitro experiments indicated that HJB could inhibit tumor cell proliferation, colony-forming, and migration ability. To further determine the in vivo activity of HJB, syngeneic and xenograft subcutaneous tumor models were constructed (Figure 2A). Consistently, HJB exerted a remarkable inhibition on tumor growth in vivo. In experiments with a syngeneic mouse LUAD model (Figure 2B), HJB treatment significantly slowed the growth and reduced the weight of Lewis tumors (Figure 2C,2D), while HJB displayed no effect on the weight of mice (Figure 2E). Similar outcomes were observed in experiments with the xenograft tumors model. In the HCC827 subcutaneous tumor model, HJB significantly inhibited tumor growth (Figure 2F-2H). In experiments with the H2228 xenograft tumor model, HJB suppressed the proliferation of subcutaneously grafted H2228 cells in nude mice (Figure 2I-2K). In conclusion, HJB significantly inhibited tumor growth in vivo.
PD-L1 served as a novel target in HJB-suppressed lung cancer
Previous reports demonstrated that HJB was a vital inhibitor of STAT3 in tumor inhibition (21,24,26). Moreover, STAT is known as a transcription factor modulating the vital immune checkpoint protein PD-L1 expression and participates in immune escape (27,28). In this section, HJB (0, 50, and 100 µM) significantly reduced STAT3 expression (Figure 3A), while STAT3 knockdown resulted in low expression of PD-L1 compared with the control cells (Figure 3B). The qPCR results also indicated higher expression of PD-L1 in LUAD cells compared to normal lung fibroblast cells (Figure 3C). The results from the human protein atlas (HPA) database suggested that the expression of PD-L1 was higher in LUAD tissue compared to normal lung tissues (Figure 3D). The WB analysis revealed that HJB reduced the protein expression of PD-L1 in LUAD cells HCC827 (Figure 3E). After successfully knocking down PD-L1 in Lewis and HCC827 cells (Figure 3F), the CCK-8 assay was employed to assess the role of PD-L1 in HJB anti-tumor activity. The results revealed that HJB clearly inhibited the proliferation of wild-type Lewis cells. When PD-L1 was knocked down, the cell viability of the shPD-L1 group was shown to be remarkably lower than that of the control group. Furthermore, the cell viability of the HJB+shPD-L1 group demonstrated no significant difference from that of the shPD-L1 group (Figure 3G). Similar outcomes were observed in experiments utilizing human LUAD cells HCC827 (Figure 3H). Therefore, HJB might inhibit the growth of lung cancer cells by targeting PD-L1.
HJB potentiated CTLA4ab therapy by down-regulating PD-L1 expression
Combinatorial therapy of PD1ab and CTLA4ab has achieved great success in improving the response and survival rates among cancer patients (33). The aforementioned experimental data indicated that HJB significantly inhibited LUAD progression by modulating PD-L1 expression. PD-L1 expressed on tumor cells promotes immune escape and plays a vital role in ICB therapy (34). Furthermore, after the tumor-bearing mice received the corresponding treatment (HJB, 5 mg/kg/2 days, i.p.) and tumors were harvested, the IHC detection of tumor tissue revealed that compared with the control group, HJB significantly increased the number of infiltrated CD8+ T cells in Lewis tumors (Figure 4A,4B). The action and related mechanism of HJB on CTLA4ab therapy were determined (Figure 4C). In the mouse syngeneic tumor model constructed by wild-type Lewis cells, HJB monotherapy, and CTLA4ab monotherapy significantly inhibited the tumor growth when compared with the control group, respectively. Furthermore, the combination of HJB and CTLA4ab significantly inhibited tumor growth compared to CTLA4ab treatment alone (Figure 4D-4F). Nonetheless, in the mouse syngeneic tumor model constructed by shPD-L1 Lewis cells, HJB treatment alone and CTLA4ab treatment alone showed no significant difference on the tumor growth inhibition compared with the control group. Moreover, the combination of HJB and CTLA4ab displayed no significant improvement in the therapeutic effect on Lewis tumor inhibition compared to CTLA4ab treatment alone (Figure 4G-4I). Collectively, HJB was found to potentiate CTLA4ab therapy by down-regulating PD-L1 expression.
Discussion
In this study, HJB, a natural diterpenoid compound derived from plants of the Euphorbiaceae family, was demonstrated to potentiate CTLA4ab ICBs therapy by inhibiting proliferation, migration, and tumorigenicity in LUAD and promoting immune activation by reducing PD-L1 expression in vivo and in vitro. This is the first study to explore the anti-tumor activity of HJB using an in vivo LUAD model, investigating its functional role in modulating the tumor immune microenvironment. The results lay the foundation for LUAD therapy, especially with ICBs therapy.
HJB is a naturally occurring ent-abietane-type diterpenoid derived from the Euphorbia plants (17). Due to its multiple potent pharmacological activities, HJB has garnered growing attention in diverse disease drug research, especially in anti-cancer drug development. Previous reports have revealed that HJB exerts beneficial effects against various cancers, such as prostate cancer (35), melanoma (36), and renal cancer (37). The mechanism of action may be associated with the suppression of the PI3K/Akt/mTOR pathway, JAK/STAT pathway, and NF-κB pathway. In this research, HJB was shown to inhibit the proliferation, migration, and tumorigenicity of LUAD in vitro and in vivo, which is consistent with the previous findings. In the study of related mechanisms, HJB suppressed LUAD progression by inhibiting STAT3 expression, which has been reported in other cancer types (26). PD-L1 may serve as a downstream target of STAT3 and participate in HJB’s activity against LUAD. PD-L1, also known as CD274 and B7-H1, is a transmembrane protein commonly expressed on the surface of tumor cells (38). A growing number of studies have reported that the function of PD-L1 is closely related to the promotion of cancer cell growth (39). For example, Qu et al. (40) demonstrated that downregulation of PD-L1 inhibited cell growth and migration. Zhang et al. (41) reported that aspirin exerted an inhibitory effect on lung cancer cells by targeting PD-L1. Similar results were found in our study, revealing that PD-L1 promoted LUAD proliferation, which was potentiated by HJB. In general, this research suggested that HJB may inhibit the proliferation, migration, and tumorigenicity of LUAD in vitro and in vivo by modulating the STAT3/PD-L1 pathway.
PD-L1 is an intrinsic immune checkpoint molecule that plays a vital role in regulating the immune balance. The PD-1/PD-L1 blockade enhanced T-cell immune responses against tumor cells (42,43). Three common approaches to PD-1/PD-L1 blockade have been developed, including (I) antibodies, (II) gene silencing, and (III) small-molecule chemicals (44). Antibody blockade and gene silencing have been largely investigated and introduced in the treatment of advanced non-small cell lung cancers and melanoma. In contrast, the small-molecule chemical approach has been less studied (45). Wang et al. identified a natural marine product, benzosceptrin C (BC), that enhanced the cytotoxicity of T cells to cancer cells by reducing the abundance of PD-L1 (46). Liu et al. demonstrated that a small molecule chemical, tubeimoside-1, promoted antitumor immunity by negatively regulating PD-L1 levels (47). In our research, PD-L1 expression was relatively high in LUAD cells HCC827 and H2228 compared to that of normal lung fibroblast cells WI38 and MRC-5. HJB significantly downregulated PD-L1 expression and induced CD8+ T cell infiltration. Moreover, HJB enhanced the effect of ICBs therapy in the murine subcutaneous model. Therefore, the above results suggested that the combination of HJB and CTLA4ab possesses highly potent antitumor activity against LUAD and may be a potential strategy in ICBs therapy.
In summary, this research indicated that HJB inhibited the proliferation, migration, and tumorigenicity of LUAD and potentiated CTLA4ab ICBs therapy by modulating the STAT3/PD-L1 pathway in vivo and in vitro.
Conclusions
Our results provided a theoretical basis for HJB’s anti-tumor activity and preliminary described its mechanism of action and its enhanced effect on ICBs therapy. Furthermore, it may help to determine HJB as a potential drug or provide a powerful leading compound structure and accelerate its application into cancer therapy. We believe that HJB may candidate as a potential drug to enhance ICBs such as cytotoxic CTLA4ab therapy and expand the benefits of immunotherapy to low-response LUAD patients. However, the limitations of this study should be acknowledged, such as if HJB was directly binding STAT3. A detailed study of the mechanism should be conducted in the next stage.
Acknowledgments
Funding: The study was supported by
Footnote
Reporting Checklist: The authors have completed the ARRIVE and MDAR reporting checklists. Available at https://jtd.amegroups.com/article/view/10.21037/jtd-24-781/rc
Data Sharing Statement: Available at https://jtd.amegroups.com/article/view/10.21037/jtd-24-781/dss
Peer Review File: Available at https://jtd.amegroups.com/article/view/10.21037/jtd-24-781/prf
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://jtd.amegroups.com/article/view/10.21037/jtd-24-781/coif). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All experiments were performed in accordance with the ethical standards of The First Affiliated Hospital of Guangzhou Medical University and the Declaration of Helsinki (as revised in 2013). All animal experiments were approved by the Animal Care and Use Committee of The First Affiliated Hospital of Guangzhou Medical University and complied with the guidelines for the ethical treatment of animals (approval No. 20240413).
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Sung H, Ferlay J, Siegel RL, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin 2021;71:209-49. [Crossref] [PubMed]
- Xu JY, Zhang C, Wang X, et al. Integrative Proteomic Characterization of Human Lung Adenocarcinoma. Cell 2020;182:245-261.e17. [Crossref] [PubMed]
- Khullar OV, Liu Y, Gillespie T, et al. Survival After Sublobar Resection versus Lobectomy for Clinical Stage IA Lung Cancer: An Analysis from the National Cancer Data Base. J Thorac Oncol 2015;10:1625-33. [Crossref] [PubMed]
- Li Y, Yan B, He S. Advances and challenges in the treatment of lung cancer. Biomed Pharmacother 2023;169:115891. [Crossref] [PubMed]
- Reck M, Remon J, Hellmann MD. First-Line Immunotherapy for Non-Small-Cell Lung Cancer. J Clin Oncol 2022;40:586-97. [Crossref] [PubMed]
- Shiravand Y, Khodadadi F, Kashani SMA, et al. Immune Checkpoint Inhibitors in Cancer Therapy. Curr Oncol 2022;29:3044-60. [Crossref] [PubMed]
- Spella M, Stathopoulos GT. Immune Resistance in Lung Adenocarcinoma. Cancers (Basel) 2021;13:384. [Crossref] [PubMed]
- Mao S, Li Y, Lu Z, et al. Systematic profiling of immune signatures identifies prognostic predictors in lung adenocarcinoma. Cell Oncol (Dordr) 2020;43:681-94. [Crossref] [PubMed]
- Rotow J, Bivona TG. Understanding and targeting resistance mechanisms in NSCLC. Nat Rev Cancer 2017;17:637-58. [Crossref] [PubMed]
- Butler MS. Natural products to drugs: natural product-derived compounds in clinical trials. Nat Prod Rep 2008;25:475-516. [Crossref] [PubMed]
- Baker DD, Chu M, Oza U, et al. The value of natural products to future pharmaceutical discovery. Nat Prod Rep 2007;24:1225-44. [Crossref] [PubMed]
- Nomura DK, Maimone TJ. Target Identification of Bioactive Covalently Acting Natural Products. Curr Top Microbiol Immunol 2019;420:351-74. [Crossref] [PubMed]
- Zhao WS, Chen KF, Liu M, et al. Investigation of targets and anticancer mechanisms of covalently acting natural products by functional proteomics. Acta Pharmacol Sin 2023;44:1701-11. [Crossref] [PubMed]
- Newman DJ, Cragg GM. Natural Products as Sources of New Drugs over the Nearly Four Decades from 01/1981 to 09/2019. J Nat Prod 2020;83:770-803. [Crossref] [PubMed]
- Yang FR, Li SY, Hu XW, et al. Identifying the Antitumor Effects of Curcumin on Lung Adenocarcinoma Using Comprehensive Bioinformatics Analysis. Drug Des Devel Ther 2022;16:2365-82. [Crossref] [PubMed]
- Xie X, Cai X, Zhou F, et al. GPR37 promotes cancer growth by binding to CDK6 and represents a new theranostic target in lung adenocarcinoma. Pharmacol Res 2022;183:106389. [Crossref] [PubMed]
- Zhang YY, Yan Y, Zhang J, et al. Jolkinolide B: A comprehensive review of its physicochemical properties, analytical methods, synthesis and pharmacological activity. Phytochemistry 2022;204:113448. [Crossref] [PubMed]
- Yan XL, Sang J, Chen SX, et al. Euphorkanlide A, a Highly Modified Ingenane Diterpenoid with a C(24) Appendage from Euphorbia kansuensis. Org Lett 2019;21:4128-31. [Crossref] [PubMed]
- Sang J, Li W, Diao HJ, et al. Jolkinolide B targets thioredoxin and glutathione systems to induce ROS-mediated paraptosis and apoptosis in bladder cancer cells. Cancer Lett 2021;509:13-25. [Crossref] [PubMed]
- Wang Y, Shen SY, Liu L, et al. Jolkinolide B inhibits proliferation or migration and promotes apoptosis of MCF-7 or BT-474 breast cancer cells by downregulating the PI3K-Akt pathway. J Ethnopharmacol 2022;282:114581.
- Wang JH, Zhang K, Niu HY, et al. Jolkinolide B from Euphorbia fischeriana Steud induces in human leukemic cells apoptosis via JAK2/STAT3 pathways. Int J Clin Pharmacol Ther 2013;51:170-8. [Crossref] [PubMed]
- Zhang J, Wang Y, Zhou Y, et al. Jolkinolide B induces apoptosis of colorectal carcinoma through ROS-ER stress-Ca(2+)-mitochondria dependent pathway. Oncotarget 2017;8:91223-37. [Crossref] [PubMed]
- Zhang H, Qian J, Jin M, et al. Jolkinolide B induces cell cycle arrest and apoptosis in MKN45 gastric cancer cells and inhibits xenograft tumor growth in vivo. Biosci Rep 2022;42:BSR20220341. [Crossref] [PubMed]
- Shen L, Zhang SQ, Liu L, et al. Jolkinolide A and Jolkinolide B Inhibit Proliferation of A549 Cells and Activity of Human Umbilical Vein Endothelial Cells. Med Sci Monit 2017;23:223-37. [Crossref] [PubMed]
- Ma YL, Tang XH, Yuan WJ, et al. Abietane Diterpernoids from the Roots of Euphorbia ebracteolata. Nat Prod Bioprospect 2018;8:131-5. [Crossref] [PubMed]
- Wang Y, Ma X, Yan S, et al. 17-hydroxy-jolkinolide B inhibits signal transducers and activators of transcription 3 signaling by covalently cross-linking Janus kinases and induces apoptosis of human cancer cells. Cancer Res 2009;69:7302-10. [Crossref] [PubMed]
- Fan Z, Wu C, Chen M, et al. The generation of PD-L1 and PD-L2 in cancer cells: From nuclear chromatin reorganization to extracellular presentation. Acta Pharm Sin B 2022;12:1041-53. [Crossref] [PubMed]
- Sasidharan Nair V, Toor SM, Ali BR, et al. Dual inhibition of STAT1 and STAT3 activation downregulates expression of PD-L1 in human breast cancer cells. Expert Opin Ther Targets 2018;22:547-57. [Crossref] [PubMed]
- Hong W, Xue M, Jiang J, et al. Circular RNA circ-CPA4/ let-7 miRNA/PD-L1 axis regulates cell growth, stemness, drug resistance and immune evasion in non-small cell lung cancer (NSCLC). J Exp Clin Cancer Res 2020;39:149. [Crossref] [PubMed]
- Xie C, Zhou X, Liang C, et al. Apatinib triggers autophagic and apoptotic cell death via VEGFR2/STAT3/PD-L1 and ROS/Nrf2/p62 signaling in lung cancer. J Exp Clin Cancer Res 2021;40:266. [Crossref] [PubMed]
- Zheng A, Li F, Chen F, et al. PD-L1 promotes head and neck squamous cell carcinoma cell growth through mTOR signaling. Oncol Rep 2019;41:2833-43. [Crossref] [PubMed]
- Liu D, Zhang Q, Wang J, et al. Inhibition of growth and metastasis of breast cancer by targeted delivery of 17-hydroxy-jolkinolide B via hyaluronic acid-coated liposomes. Carbohydr Polym 2021;257:117572. [Crossref] [PubMed]
- Callahan MK, Postow MA, Wolchok JD. CTLA-4 and PD-1 Pathway Blockade: Combinations in the Clinic. Front Oncol 2014;4:385. [Crossref] [PubMed]
- Jiang X, Wang J, Deng X, et al. Role of the tumor microenvironment in PD-L1/PD-1-mediated tumor immune escape. Mol Cancer 2019;18:10. [Crossref] [PubMed]
- Yan XL, Zhang JS, Huang JL, et al. Euphonoids A-G, cytotoxic diterpenoids from Euphorbia fischeriana. Phytochemistry 2019;166:112064. [Crossref] [PubMed]
- Gao C, Yan X, Wang B, et al. Jolkinolide B induces apoptosis and inhibits tumor growth in mouse melanoma B16F10 cells by altering glycolysis. Sci Rep 2016;6:36114. [Crossref] [PubMed]
- Mangisa M, Tembu VJ, Fouche G, et al. Ent-abietane diterpenoids from Suregada zanzibariensis Baill. (Euphorbiaceae), their cytotoxic and anticancer properties. Nat Prod Res 2019;33:3240-7. [Crossref] [PubMed]
- Wu Y, Chen W, Xu ZP, et al. PD-L1 Distribution and Perspective for Cancer Immunotherapy-Blockade, Knockdown, or Inhibition. Front Immunol 2019;10:2022. [Crossref] [PubMed]
- Dong P, Xiong Y, Yue J, et al. Tumor-Intrinsic PD-L1 Signaling in Cancer Initiation, Development and Treatment: Beyond Immune Evasion. Front Oncol 2018;8:386. [Crossref] [PubMed]
- Qu QX, Xie F, Huang Q, et al. Membranous and Cytoplasmic Expression of PD-L1 in Ovarian Cancer Cells. Cell Physiol Biochem 2017;43:1893-906. [Crossref] [PubMed]
- Zhang Y, Lv C, Dong Y, et al. Aspirin-targeted PD-L1 in lung cancer growth inhibition. Thorac Cancer 2020;11:1587-93. [Crossref] [PubMed]
- Sun C, Mezzadra R, Schumacher TN. Regulation and Function of the PD-L1 Checkpoint. Immunity 2018;48:434-52. [Crossref] [PubMed]
- Keir ME, Butte MJ, Freeman GJ, et al. PD-1 and its ligands in tolerance and immunity. Annu Rev Immunol 2008;26:677-704. [Crossref] [PubMed]
- Yi M, Zheng X, Niu M, et al. Combination strategies with PD-1/PD-L1 blockade: current advances and future directions. Mol Cancer 2022;21:28. [Crossref] [PubMed]
- Li K, Tian H. Development of small-molecule immune checkpoint inhibitors of PD-1/PD-L1 as a new therapeutic strategy for tumour immunotherapy. J Drug Target 2019;27:244-56. [Crossref] [PubMed]
- Wang Q, Wang J, Yu D, et al. Benzosceptrin C induces lysosomal degradation of PD-L1 and promotes antitumor immunity by targeting DHHC3. Cell Rep Med 2024;5:101357. [Crossref] [PubMed]
- Liu X, Yin M, Dong J, et al. Tubeimoside-1 induces TFEB-dependent lysosomal degradation of PD-L1 and promotes antitumor immunity by targeting mTOR. Acta Pharm Sin B 2021;11:3134-49. [Crossref] [PubMed]

