Application of novel dark-quencher labeled probes in multiplex qRT-PCR assays for rapid detection of SARS-CoV-2 variants
Highlight box
Key findings
• The novel probe dark quencher (DQ) probe [dihydropyrroloindole carboxylate (DPI3)-analogue] showed great analytical sensitivity (limit of detection of 250 copies/mL), good specificity (no cross-reaction with other pathogens), and great clinical performance (99.4–100% consistency with next-generation sequencing) were demonstrated by the designed multiplex quantitative reverse transcription-polymerase chain reaction tests.
What is known and what is new?
• The designed DQ probe modification can be selectively attached to a minor groove in the DNA molecule. DPI3 labeled oligonucleotides can form stable heterozygous complexes with complementary DNA and RNA targeted sequences to increase the Tm values; furthermore, DPI3 analogue can selectively link to oligonucleotides without the need to connect to quenched groups like minor groove binder.
• This assay could target nine key mutations for identifying severe acute respiratory syndrome coronavirus type 2 infection (SARS-CoV-2) variants to provide a useful tool for epidemiological surveillance of circulating SARS-COV-2 variants.
What is the implication, and what should change now?
• The designed DQ probe can be designed to detect more pathogens, especially for the patients with multiple infections and it can be convenient used in routine equipment and application in hospitals. The innovative diagnostic technology can improve the early diagnosis rate and treatment effect of diseases, and be better applied in clinic.
Introduction
The coronavirus disease 2019 (COVID-19) pandemic caused by severe acute respiratory syndrome coronavirus type 2 infection (SARS-CoV-2) has seriously and globally affected the health and life of people and caused serious economic losses. SARS-CoV-2 has a feature of rapid mutation giving rise to many variants that can spread rapidly and widely across the globe and lead to fast transmission and immune evasion (1). The significant variants are Delta and Omicron and their lineages which have been identified as variants of concern by the World Health Organization. Efforts to prompt detection of the ongoing appearance of mutant strains are urgently needed (2,3).
The Delta variant (B.1.617.2) was discovered in India at the end of 2020 (2,4). In November 2021, the Omicron variant (B.1.1.529) emerged and spread rapidly around the world. Subsequently, the Omicron variant mutated into four subvariants BA.1, BA1.1, BA.2, and BA.3 (5). The BA.2.12.1 subvariant of Omicron appeared in May of 2022 (6). BA.4 was first discovered in mid-December 2021, whereas BA.5 first appeared around January, 2022 (7). BA.2.12.1, BA.4, and BA.5 were found to be more infectious than BA.2 (8), while the high viral load and infectivity of Delta and Omicron variants were shown to increase the risk of aerosol transmission. The BA.1 and BA.1.1 variants are extremely similar, BA.1.1 has an additional R346K mutation in spike protein. BA.3 contains the same mutations as BA.1 (including P681H, Q493R, S371F, and 6970del), but lacks T547K mutation. BA.2.12.1 of the BA.2 lineage has two additional unique mutations, L452Q and S704F. Mutations in BA.4 and BA.5, in addition to the mutations in BA.2, also have the rare mutations L452R and F486V. Among the SARS-CoV-2 variants, Delta has a unique mutation, P681R (6,9-11). Omicron EG.5 and EG.5.1 have been reported recently. EG.5 was first reported on February 17, 2023, and it carries an additional F456L mutation in comparison to XBB.1.5. In addition, EG.5.1, as opposed to EG.5, includes an additional spike mutation Q52H (12). In 2023, the emergence and global spread of JN.1, a sub-lineage of BA.2.86. Compared to BA.2.86, JN.1 contains mutations R3821K in ORF1a, L455S in the Spike protein, and F19L in ORF7b (13).
Next-generation sequencing (NGS) is the gold standard applied broadly to monitor the SARS-COV-2 mutations (14). However, NGS requires specific equipment and is expensive and time consuming hindering its widespread application. Therefore, the application of multiplex polymerase chain reaction (PCR) in the detection of SARS-CoV-2 mutants has been studied since the beginning of the epidemic (15-17). Stanhope et al. (17) and Yeung et al. (18) demonstrated a multiplex PCR technique in their study to identify several strains of variant of concerns (VOCs), including Alpha (B.1.1.7 and its sublineages), Beta (B.1351), Gamma (P.1 and its sublineages), Delta (B1.617.2 and its sublineages), and Omicron (B1.529 and its sublineages). Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was employed to detect particular mutations in the receptor binding domain (RBD), including L452R, E484K, and N501Y (assay 1), as well as 6970del, K417N, and T478K changes (assay 2). But the assay failure rate across all tested samples in their initial cohort was 14% (18). Chung et al. also developed a freely available PCR method to monitor the transmission of B.1.1.7, B.1.351, P.1, and B.1.617.2 variations. The limit of detection (LoD) of the test was infrequently found to be 3,000 copies/mL (19). In addition, TaqMan® probes and TaqMan® Minor Groove Binder (MGB) probes have been used and compared. Although both TaqMan probes and TaqMan® MGB probes produce comparable sensitivities and linear ranges, TaqMan® MGB probes exhibit less mismatch discrimination than TaqMan® probes, making TaqMan® MGB probes better suited for identifying single nucleotide polymorphism (SNPs); however, it has been pointed out that optimization reaction conditions and verification of specificity are required for TaqMan® MGB probes (20). Overall, the studies highlighted a significant limitation. Because of the inclusion of several sets of primers and probes, multiplex qRT-PCRs are consequently less analytically sensitive compared to single-target assays. As such, new techniques must be developed to enhance the specificity and sensitivity of existing methods. Therefore, we designed a novel probe dark quencher (DQ) probe that can solve the problem of low specificity and sensitivity in multiple qRT-PCR analysis via modification of the conventional. The DQ probe [dihydropyrroloindole carboxylate (DPI3)-analogue] modification can be selectively attached to a minor groove in the DNA molecule. DPI3 labeled oligonucleotides can form stable heterozygous complexes with complementary DNA and RNA targeted sequences to increase the Tm values; furthermore, DPI3 analogue can selectively link to oligonucleotides without the need to connect to quenched groups like MGB. By using this connection strategy, the issue of MGB choosing a single quenching group in multiplex PCR is resolved, this prevents fluorescence interference caused by single quenching group’s inadequate absorption of fluorescence emitted by several reporting groups.
In this study, we used a self-developed DQ labeled probes with high-specificity to improve multiplex qRT-PCR assays. Our assays target nine key mutations for identifying SARS-CoV-2 Delta, Omicron BA.1, BA.1.1, BA.2, BA.2.12.1, BA.3, BA.4 and BA.5 variants to provide a useful tool for epidemiological surveillance of circulating SARS-COV-2 variants. We present this article in accordance with the MDAR reporting checklist (available at https://jtd.amegroups.com/article/view/10.21037/jtd-24-853/rc).
Methods
Ethical statement
The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The study was approved by Ethics Committee of the First Affiliated Hospital of Guangzhou Medical University with the project identification code, ES202304201 and informed consent was taken from all the patients.
Primer and probe design, and their evaluation
SARS-CoV-2 genomic sequence of 1,093,239 bp was retrieved from GISAID (https://www.gisaid.org). Sequence alignment was performed using the MUSCLE algorithm in Molecular Evolutionary Genetics Analysis (MEGA) v7.0 software. The main mutations in the Omicron BA.1, BA.1.1, BA.2, BA.2.12.1, BA.3, BA.4, and BA.5, and Delta variants were identified and genomic regions suitable for primer/probe design were selected by Primer 5 (Premier, Canada), as shown in Table 1. We developed a novel probe named DQ; the DQ motif is DPI 3 analogue which is linked to the first base at 3' end of the target probe sequence (Figure 1A) and the structure of DPI 3 analogue is displayed in Figure S1. To evaluate the effectiveness of DQ labeled probes, qRT-PCR experiments were conducted to evaluate SNP amplification efficiency and specificity and the ability to detect multiple mutation sites. The plasmids containing single L452R and P681H mutations in the SARS-CoV-2 Spike protein fragment were used for templates with tenfold dilutions (from 101 to 107). The probe concentration was 200 nM, and the forward and reverse PCR primers were 400 nM for each. One PCR was run in triplicate. Optimization of the DQ probe was performed using the following conditions: 50 ℃ reverse transcription for 15 min and denaturation at 95 ℃ for 5 min followed by 40 cycles of 95 ℃ for 10 s and 60 ℃ for 30 s, on the ABI 7500 (Thermo Fisher Scientific, Waltham, MA, USA) instrument. TaqMan® and TaqMan® MGB probes were run in parallel for comparison. R2 (R square), coefficient of variation (CV) and standard deviation (SD) values were calculated. All these probes detected 105 copies/mL of plasmids containing single L452R and P681H mutations. A corresponding wild-type fragment was used as a control. The cycle threshold (CT) value was detected to evaluate specificity. To test multiple mutation sites in one PCR reaction simultaneously, 105 copies/mL of plasmids, each containing L452R, P681H, and T821I mutations respectively, were mixed and assayed using TaqMan® MGB and DQ probes. Individual plasmids were run in parallel as controls. CT values were determined to compare the detection efficacy of the two different probes.
Table 1
| Assay | Gene | Forward primer (5'-3') | Probe (5'-3') | Reverse primer (5'-3') |
|---|---|---|---|---|
| 1 | ORF | GTAGCTTGTCACACCGTTTC | FAM-ATAGTGAACCGCCACACATGACCAT-BHQ1 | CATCTCCTGATGAGGTTCCAC |
| N | GTGATGCTGCTCTTGCTTTG | ROX-TGCTGCTTGACAGATTGAACCAG-BHQ2 | ACAGTTTGGCCTTGTTGTTG | |
| 2 | 6970del | ATTCAACTCAGGACTTGTTCTTAC | FAM-TCCCAGAGATAACATGGAACC-BHQ1 | AAATGGTAGGACAGGGTTATCAA |
| T547K | ACTGTTTGTGGACCTAAAAAGTCT | ROX-CCTGTGCCTTTTAAAC(DQ)-BHQ2 | AAGTGTCTGTGGATCACGGAC | |
| R346K | TTCCTAATATTACAAACTTGTGCC | CY5-AACGCCACCAAATTTG(DQ)-BHQ3 | GGACAGAATAATCAGCAACACA | |
| 3 | L452R | AATTCTAACAAGCTTGATTCTAAGG | FAM-ATCTATACCGGTAATT(DQ)-BHQ1 | TGAAATATCTCTCTCAAAAGGTTT |
| P681H | GTGCAGGTATATGCGCTAGTTA | ROX-TGCCCGCCGATGAGA(DQ)-BHQ2 | GTGTAGGCAATGATGGATTGA | |
| T842I | AGGTTACTTTTGGTGATGACACTG | CY5-AGTGTGAATATCATTTTT(DQ)-BHQ3 | CTGTATAGGCAGAGCACTTCTCA | |
| 4 | L452Q | AATTCTAACAAGCTTGATTCTAAGG | ROX-CAATCTATACTGGTAATT(DQ)-BHQ2 | TGAAATATCTCTCTCAAAAGGTTT |
| KSF141-143 | TTCGTAAGAACGGTAATAAAGGA | CY5-CGATCTAGACTTAGGCGACGA-BHQ3 | TCACGGGTAACACCACTGCTA | |
| P681R | GTGCAGGTATATGCGCTAGTTA | FAM-TGCCCGCCGACGAGA(DQ)-BHQ1 | GTGTAGGCAATGATGGATTGA |
Sequences of primers and probes for each mutation site. Italicized nucleotides within the probe sequences represent the mutations at each site; 6970del and KSF141-143 are base deletions. DQ motif is DPI 3 analogue which is linked to the first base at 3' end of the target probe sequence. BHQ, black hole quencher; DPI 3, dihydropyrroloindole carboxylate; DQ, dark quencher; qRT-PCR, quantitative real-time polymerase chain reaction.
Development of multiplex qRT-PCR assays
Multiplex qRT-PCR mixtures were diluted with RNase-free water to a final volume of 20 µL and included 5 µL 5× RT-PCR buffer (Zhuhai BestyGene Technology Co., Ltd., China), 0.2 µL dNTPs (25 mM) (Zhuhai BestyGene Technology Co., Ltd.), 0.3 µL Taq DNA polymerase (5 U/µL; Zhuhai BestyGene Technology Co., Ltd.), and 0.3 µL Moloney murine leukemia virus (MMLV) (200 U/µL). The concentrations of primer/probe sets (400 nM for each primer, and 200 nM for the probe) were optimized in advance. Each reaction was run in triplicate in 96-well plates using an ABI 7500 (Thermo Fisher Scientific). The thermocycling conditions used were as described above. A melting curve analysis (58–62 ℃) was performed in advance to optimize annealing and extension temperatures. Fluorescence detection was conducted at the annealing/extension step of each cycle. The multiplex qRT-PCR assays targeted nine specific mutations (Figure 1B) and were developed to differentiate the SARS-CoV-2 Delta variant and the Omicron subvariants, BA.1, BA.1.1, BA.2, BA.2.12.1, BA.3, BA.4, and BA.5. Each reaction targeted the ORF gene and the specific mutations of each variant (Figure 1C). Each reaction contained mutation-targeting DQ labeled probes. The variation between the ORF and mutation CT values (ΔCT) was determined (Figure 1D). A mutation was determined by the difference in CT values between the ORF gene and each mutation. The threshold was set according to the assays developed to analyze Omicron variant samples.
Evaluation of the multiplex qRT-PCR assays
To determine the sensitivity of the multiplex qRT-PCR assays, we used the target variant in a SARS-CoV-2 positive sample. For quantitative assays, we first used an in vitro transcribed RNA of SARS-CoV-2 to construct a standard curve with qRT-PCR, the standard had a range from 125 to 4,000 copies/mL. We further determined the sensitivity of the multiplex qRT-PCR assays. We targeted different variants in SARS-CoV-2 positive clinical samples, which included known variants of Delta, Omicron BA.1, BA.1.1, BA.2, BA.2.12.1, BA.4, and BA.5. After the viral quantitation had been determined, the samples were serially 2-fold diluted from 4,000 to 125 copies/mL and subjected to the multiplex allele-specific qRT-PCR assays. Due to lack of Omicron BA.3 samples during the study period, this variant was tested using a plasmid containing the targeted fragment. The LoD of ORF/N genes in each qRT-PCR assay was determined by 20 detections at 95% probability. The linear detection ranges of the developed multiplex qRT-PCR assays were determined by the coefficient of correlation (R2) ranging from 0 to 1 (close to 1 represents a strong correlation) from 4,000 to 250 copies/mL. Variation in CT values (ΔCT) between the targeted mutant Spike gene and ORF gene was determined for the wild type at 10,000 and 5,000 copies/mL by three reactions and further determined for BA.1, BA.2, BA.5, and Delta in clinical samples.
Specificity of the assays was evaluated by checking possible cross-reactivity of the qRT-PCR assays with nucleic acids from common respiratory viruses, including coronaviruses (HKU1, NL63, OC43, and 229E), influenza viruses (A and B), adenovirus, respiratory syncytial virus, parainfluenza viruses (types 1–3), rhinovirus, human metapneumovirus, and herpes simplex virus, and respiratory bacteria including Chlamydia trachomatis and Mycoplasma pneumoniae (21).
Evaluation of the clinical performance of the multiplex qRT-PCR assays
Clinical specimens (sputum and throat swabs) were collected from suspected COVID-19 patients and stored in viral transport media. All clinical specimens were processed in a biosafety level 3 laboratory. Total nucleic acids were extracted using nucleic acid extraction reagent (Shengxiang, China). We performed assay validation with 168 nasopharyngeal swabs. Detection of SARS-CoV-2 variants was performed by the multiplex qRT-PCR assays and confirmed by NGS.
NGS
Nucleic acid extraction was performed using a KingFisher automatic nucleic acid extraction instrument (England, London) and the Magen pathogenic nucleic acid kit (Article number: R6672B-F-96/48/24, Guangzhou Magen Biotechnology Co., Ltd.). After cDNA synthesis and library preparation using a KS608-50SHXD96 kit (KingCreate, Guangzhou, China), a Qubit dsDNA HS Assay Kit (Invitrogen, Waltham, USA) was used for library pooling. Library fragment size was detected using a Qsep100 automatic nucleic acid protein analyzer and a Standard Cartridge Kit (S2) kit. Finally, the MiniSeqDx gene sequencer (KMMiniSeqDx-CN, National Instrument registration 20203220340) was used to obtain sequencing data.
Statistical analysis
All experiments were performed in triplicate, and data are expressed as the mean ± SD. Linearity of each site in sensitivity verification was generated using Excel® Microsoft® 365. The linearity of each site from 125 to 4,000 copies/mL was described by R2. A positive detection rate of 95% was used to determine the LoD. The Kappa index, which assesses agreement between NGS and the developed multiplex qRT-PCR assays, was calculated by Kappa in SPSS 26.0.
Results
Performance of the DQ labeled probe for SARS-CoV-2 mutation detection
Experiments testing the sensitivity and amplification efficiency of TaqMan, TaqMan® MGB and DQ probes revealed that the L452R and P681H mutant alleles were amplified with low CV values and had a good linear range (R2>99%) with all three probes (Table 2). In specific studies, three probes were used to amplify the L452R and P681H mutant alleles from 105 copies/mL of plasmids together with the prototype wild-type allele for comparison. The TaqMan® probes for L452R and P681H amplified fragments containing both the mutant alleles and the prototype allele, which resulted in insufficient specificity (Table 3). The three plasmids containing the L452R, P681H, and T842I mutant fragments, were then mixed at the same concentration of 105 copies/mL. Single DQ probe or TaqMan® MGB probe against L452R, P681H, and T842I, respectively, was added into the mixture. Reactions contained only one plasmid type and corresponding probes were run in parallel. While the CT values for TaqMan® MGB probe detection of these individual mutant alleles compared with detection of the alleles in the mixture varied on average more than 3 CT units (Figure 2, Table 4), the CT values for DQ probe detection of individual mutant alleles (L452R, P681H, and T842I) compared with detection of the alleles in the mixture were quite consistent (Table 4). These results unequivocally demonstrate that when compared to the TaqMan® MGB probe, the DQ probe is more effective in identifying different mutations.
Table 2
| Copies/mL | L452R | P681H | |||||
|---|---|---|---|---|---|---|---|
| TaqMan | TaqMan® MGB | DQ | TaqMan | TaqMan® MGB | DQ | ||
| 107 | 15.87±0.07 | 15.67±0.1 | 15.49±0.13 | 16.50±0.06 | 16.04±0.07 | 16.59±0.1 | |
| 106 | 18.88±0.08 | 18.62±0.03 | 18.60±0.12 | 19.47±0.11 | 19.45±0.15 | 19.76±0.13 | |
| 105 | 22.14±0.18 | 21.83±0.14 | 22.13±0.07 | 22.78±0.14 | 22.96±0.17 | 23.18±0.19 | |
| 104 | 25.44±0.29 | 25.48±0.23 | 25.54±0.12 | 25.89±0.12 | 26.26±0.1 | 26.68±0.2 | |
| 103 | 28.99±0.15 | 28.43±0.3 | 28.72±0.12 | 29.53±0.16 | 29.85±0.17 | 30.27±0.28 | |
| 102 | 32.31±0.15 | 32.25±0.11 | 32.57±0.21 | 33.08±0.18 | 33.28±0.25 | 33.69±0.25 | |
| 10 | 36.09±0.5 | 35.65±0.44 | 35.76±0.22 | 36.76±0.6 | 36.52±0.38 | 37.37±0.53 | |
| R2 | 0.99 | 0.99 | 0.99 | 0.9 | 0.99 | 0.99 | |
Data are presented as cycle threshold ± standard deviation. DQ, dark quencher; MGB, minor groove binder.
Table 3
| Allele | L452R | P681H | |||||
|---|---|---|---|---|---|---|---|
| TaqMan | TaqMan® MGB | DQ | TaqMan | TaqMan® MGB | DQ | ||
| Mutated allele | 27.72±0.16 | 27.95±0.04 | 28.22±0.13 | 29.40±0.17 | 31.58±0.27 | 31.26±0.03 | |
| Prototype allele | 27.91±0.07 | NT | NT | 29.90±0.07 | NT | NT | |
Data are presented as cycle threshold value ± standard deviation. DQ, dark quencher; MGB, minor groove binder; NT, negative.
Table 4
| Plasmid | Probe | TaqMan® MGB | DQ |
|---|---|---|---|
| L452R/P681H/T842I mixture | L452R | 31.98±0.53 | 29.04±0.11 |
| L452R | L452R | 30.64±0.15 | 29.04±0.1 |
| L452R/P681H/T842I mixture | P681H | 31.17±0.47 | 28.56±0.3 |
| P681H | P681H | 30.24±0.17 | 28.5±0.17 |
| L452R/P681H/T842I mixture | T842I | 33.16±0.54 | 29.11±0.31 |
| T842I | T842I | 31.17±0.32 | 29.53±0.19 |
Data are presented as cycle threshold value ± standard deviation. CT, cycle threshold; DQ, dark quencher; MGB, minor groove binder.
Analytical sensitivities of the developed multiplex qRT-PCR assays
The analytical sensitivities of the developed qRT-PCR assays were assessed according to the LoD, which is the minimum detected template concentration at 95% probability. A 2-fold serial dilution of wild-type SARS-CoV-2 in vitro transcription RNA standard (from 125 to 4,000 copies/mL) was prepared and analyzed three times at each concentration. ORF gene LoDs were determined at 125 and 250 copies/mL (Tables S1,S2). Both O and N genes were detected 19 times in 20 repetitions at 250 copies/mL, with the CT value <38 cycles and a detection rate of 95%. However, in the 20 repeated tests at 125 copies/mL, the detection rate was <95%. Therefore, the CT value <38 cycles was set as positive for the wild type. In accordance with the wild-type LoD, 2-fold serially diluted clinical samples of BA.1, BA.1.1, BA.2, BA.4, BA.5, BA.2.12.1, and Delta from 250 to 4,000 copies/mL were used to analyze the sensitivities of the qRT-PCR assays (Figure 3). CT values and SDs are shown in Table S3. These results indicated outstanding analytical sensitivities of the multiplex qRT-PCR assays. Moreover, the linear detection ranges of the multiplex qRT-PCR assays were determined by the coefficient of correlation (R2), which ranges from 0 to 1 (close to 1 represents a strong correlation) (Table 5). In the wild-type reactions, the linear detection ranges for the ORF and N genes were between 250 and 4,000 copies/mL per reaction (R2>0.98). In the BA.1 reactions, the linear detection ranges for the ORF and N genes were 250 to 4,000 copies/mL per reaction (R2>0.98), whereas the linear detection ranges for the mutant alleles, 6970del (Spike), L452R (Spike), T547K (Spike), and P681H (Spike) were 250 to 4,000 copies/mL per reaction (R2>0.96). In the BA.2 reaction, the linear detection ranges for P681H (Spike) and T842I (NSP3) were 250 to 4,000 copies/mL per reaction (R2>0.98), whereas the R2 was >0.97 for the ORF gene and >0.95 for the N gene. In the BA.4 reaction, the linear detection ranges were 250 to 4,000 copies/mL per reaction (R2>0.98) for the ORF and N genes, 6970del (Spike), P681H (Spike), I842I (NSP3) and KSF141-143 (NSP1), whereas R2>0.96 was observed for L452R. The linear detection ranges of BA.5 were between 250 and 4,000 copies/mL per reaction (R2>0.98) for the ORF and N genes, 6970del (Spike), L452R (Spike), and I842I (NSP3); however, the R2 for P681H (Spike) was >0.97. For BA.1.1, the linear detection ranges for the ORF and N genes, 6970del (Spike), and T547K (Spike) were 250 to 4,000 copies/mL per reaction (R2>0.98), whereas the R2 of R346K (Spike) was >0.96 and >0.92 for P681H (Spike). In the BA2.12.1 reaction, the linear detection ranges were 250 to 4,000 copies/mL per reaction (R2>0.98) for ORF and N genes, P681H (Spike) and T842I (NSP3), and the R2 of L452Q (Spike) was >0.91. The linear detection ranges of Delta were 250 to 4,000 copies/mL per reaction (R2>0.95) for ORF and N genes and L452R and the R2 of P681R was >0.98. These results demonstrated wide linear detection ranges of the developed multiplex allele-specific qRT-PCR assays for differentiation of SARS-CoV-2 Delta variant and Omicron subvariants, BA.1, BA.1.1, BA.2, BA.3. BA.2.12.1, BA.4, and BA.5.
Table 5
| Assay | Gene | R2 | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Wild type | BA.1 | BA.2 | BA.3 | BA.4 | BA.5 | BA.1.1 | BA.2.12.1 | Delta | ||
| 1 | ORF | 0.99 | 0.98 | 0.98 | 0.96 | 0.99 | 0.99 | 0.98 | 0.99 | 0.98 |
| N | 0.99 | 0.99 | 0.96 | 0.98 | 0.99 | 0.99 | 0.99 | 0.99 | 0.96 | |
| 2 | 6970del | NT | 0.99 | NT | 0.99 | 0.99 | NT | 0.99 | NT | NT |
| T547K | NT | 0.99 | NT | NT | NT | NT | 0.98 | NT | NT | |
| R346K | NT | NT | NT | NT | NT | NT | 0.97 | NT | NT | |
| 3 | L452R | NT | NT | NT | NT | 0.97 | 0.99 | NT | NT | 0.95 |
| P681H | NT | 0.96 | 0.98 | 0.99 | 0.98 | 0.98 | 0.92 | 0.98 | NT | |
| T842I | NT | NT | 0.99 | NT | 0.99 | 0.98 | NT | 0.99 | NT | |
| 4 | L452Q | NT | NT | NT | NT | NT | NT | NT | 0.91 | NT |
| KSF141-143 | NT | NT | NT | NT | 0.99 | NT | NT | NT | NT | |
| P681R | NT | NT | NT | NT | NT | NT | NT | NT | 0.99 | |
R2, the linear detection ranges between 250 and 4,000 copies/mL per reaction. NT, negative; SARS-CoV-2, severe acute respiratory syndrome coronavirus 2.
Setting the ΔCT value of the multiplex qRT-PCR assays for detecting mutation
To set the ΔCT value of the multiplex qRT-PCR assays, we used wild-type SARS-CoV-2 (standard). Wild-type SARS-CoV-2 was diluted to 100,000, 10,000, and 5,000 copies/mL. ΔCT values and the ΔCT average are shown in Table S4. The minimum ΔCT average of the non-corresponding gene mutation was 8.14. Additionally, ΔCT values and the ΔCT average of corresponding gene mutation sites were calculated for BA.1, BA.2, BA.5, and Delta (Table S5). We found that the CT values of variants were less than 38 cycles, which was the same as the wild type, and that the ΔCT value between ORF and non-corresponding gene mutations was more than 8 cycles. Overall, we set a CT value <38 cycles for ORF and a ΔCT value ≤8 cycles for specific mutation sites as positive for the mutant variants.
Specificity of the multiplex qRT-PCR assays
We tested 75 clinical samples with known other respiratory pathogens [influenza A virus (FA), influenza B virus (FB), adenovirus, respiratory syncytial virus, human parainfluenza virus, rhinovirus, human metapneumovirus, herpes simplex virus type, SARS-HKU1, SARS-NL63, SARS-OC43, SARS-229E, Bacillus pertussis, Chlamydia trachomatis, and Mycoplasma pneumoniae; five cases each] to verify the specificity of the developed assays. No cross-reactivity was observed with the multiplex qRT-PCR assays (Figure S2), indicating good specificity of the multiplex qRT-PCR assays.
Clinical performance of the developed multiplex qRT-PCR assays
We further tested and compared the developed multiplex qRT-PCR assays with NGS on 168 clinical specimens to evaluate the clinical performance of the developed assays, the results were shown in Table 6. Compared with NGS, the sensitivities of the developed assays for detecting Omicron variants BA.1, BA.2, BA.4, BA.5, and BA.2.12.1 and Delta were 100%, 95.8%, 100%, 100%, 100%, and 95%, respectively. The specificity of all multiplex qRT-PCR assays compared with NGS to detect the Omicron variants BA.1, BA.2, BA.4, BA.5, and BA.2.12.1 and Delta was 100% (kappa =1.000, P>0.05), 99.4% (kappa =0.975, P>0.05), 100% (kappa =1.000, P>0.05), 100% (kappa =1.000, P>0.05), and 100% (kappa =1.000, P>0.05), and (kappa =0.971, P>0.05) consistent, respectively. These results indicate that the specificity and sensitivity of the developed multiplex allele-specific qRT-PCR assays on the studied SARS-CoV-2 variants in clinical samples are no less than that of NGS.
Table 6
| Subjects | Developed assay | NGS | Performance characteristics | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Positive | Negative | Sensitivity (%) | Specificity (%) | Youden’s index | PPV (%) | NPV (%) | Agreement (%) | Kappa | |||
| Omicron BA.1 | Positive | 9 | 0 | 100 | 100 | 1 | 100 | 100 | 100 | 1 | |
| Negative | 0 | 159 | |||||||||
| Total | 9 | 159 | |||||||||
| Omicron BA.2 | Positive | 23 | 0 | 95.8 | 100 | 0.958 | 95.8 | 100 | 99.4 | 0.975 | |
| Negative | 1 | 144 | |||||||||
| Total | 24 | 144 | |||||||||
| Omicron BA.4 | Positive | 8 | 0 | 100 | 100 | 1 | 100 | 100 | 100 | 1 | |
| Negative | 0 | 160 | |||||||||
| Total | 8 | 160 | |||||||||
| Omicron BA.5 | Positive | 31 | 0 | 100 | 100 | 1 | 100 | 100 | 100 | 1 | |
| Negative | 0 | 137 | |||||||||
| Total | 31 | 137 | |||||||||
| BA2.12.1 | Positive | 1 | 0 | 100 | 100 | 1 | 100 | 100 | 100 | 1 | |
| Negative | 0 | 167 | |||||||||
| Total | 1 | 167 | |||||||||
| Delta | Positive | 19 | 0 | 95 | 100 | 0.95 | 95 | 100 | 99.4 | 0.971 | |
| Negative | 1 | 148 | |||||||||
| Total | 20 | 148 | |||||||||
Sensitivity = TP / (TP + FN) × 100%, specificity = TN / (TN + FP) × 100%, PPV = TP / (TP + FP) × 100%, NPV = TN / (TN + FN) × 100%, agreement = (TP + TN) / (TP + FP + TN + FN) × 100%, Youden’s index = (sensitivity + specificity) – 1. The kappa index, which assesses agreement between NGS and the developed multiplex qRT-PCR assays, was calculated by Kappa in SPSS 26.0. FN, false negative; FP, false positive; NGS, next generation sequence; NPV, negative predictive value; PPV, positive predictive value; qRT-PCR, quantitative real-time polymerase chain reaction; SARS-CoV-2, severe acute respiratory syndrome coronavirus 2; TN, ture negative; TP, ture positive.
Discussion
In this study, we developed and used the novel DQ labeled probes for SARS-CoV-2 multiplex qRT-PCR assays to distinguish between Delta and Omicron variants of SARS-CoV-2 (BA.1, BA.2, BA.3, BA.4, BA.5, BA.2.12.1, and BA1.1). The DQ probe was designed with reference to the DPI 3 structure, enabling the DNA double-strand MGB to be directly used for solid-phase oligonucleotide synthesis. Overall, the number of bases of MGB probe and DQ probe is shorter than the ordinary TaqMan® probe. The fluorescence signal can be specific to the target sequence with shorter bases. The TaqMan® probe needs to increase the base number of the probe to increase the annealing temperature, but the MGB probe and the DQ probe do not need to increase the base number of the probe to increase the annealing temperature to improve the specificity of the amplification product. MGB probe is widely recommended for SNP detection with its good specificity (22,23). However, in case of the same number of bases, the DQ probe shows higher Tm values than MGB probe. Therefore, DQ probe shows better specificity in SNP detection of multiplex PCR and it can optimize the reduction of the signal interference of amplification and identify mutation sites. In addition, the TaqMan® MGB probe has a non-fluorescent quenching group (NFQ) that only links the quenching group MGB. However, the DQ probe can connect different quenching groups, which can match different fluorescent groups and reduce the inhibition of amplification in multiple PCR, showing excellent quenching effect (Table 7).
Table 7
| Probe type | Probe base length (bp) | Melting temperature (℃)† | Specificity in multiplex PCR |
|---|---|---|---|
| TaqMan® probe | 25–32 | 6–8 | Lack of specificity |
| TaqMan® MGB | 14–25 | 8–10 | High specificity, TaqMan® MGB probe, linked to a single quenching group |
| DQ | 14–25 | 10–15 | High specificity. It can combine a variety of quenching groups to match a variety of fluorescent groups to reduce the signal interference of amplification |
†, compared with primers in the case of the same number of bases. DQ, dark quencher; MGB, minor groove binder; PCR, polymerase chain reaction.
In view of this, the SARS-CoV-2 multiplex qRT-PCR assays were developed based on the specific mutations recognized by the primers and DQ probes. The SARS-CoV-2 multiplex qRT-PCR assays presented a good linear range (R2>99%) and had excellent specificity and sensitivity for SARS-CoV-2 variant detection.
Many methods have been used to detect SARS-CoV-2. Sanger sequencing is considered the gold standard to validate DNA sequences (24,25). However, Sanger sequencing has low sensitivity and it is not as cost effective for large numbers of targets. Novel diagnostic technology based on CRISPR-Cas12/13 gene editing has been used to identify SARS-CoV-2. CRISPR-Cas12/13 combined with isothermal amplification is being developed for diagnostic use. These two technologies have been combined to enable single tube assays that can achieve rapid detection with high sensitivity (26-29). However, most of the currently developed CRISPR assays do not address simultaneous detection of multiple targets. In addition, a disadvantage of CRISPR methods for diagnosis is off target detection. The Cas proteins of the CRISPR system have nucleotide mismatch tolerance, which can cause non-specific binding. Therefore, this technology is not widely used at present (30,31). NGS is applicable, but it is time consuming (24,32) and difficult to apply widely in primary hospitals. There are many multiplex PCR tests for SARS-CoV-2 variants; however, many of them are based on various mutations in the SARS-CoV-2 Spike protein (e.g., 69-70del, K417N/T, L452R, T478K, E484K/Q, N501Y, and E484A) (5,18,33). A melting curve-based SNP assay was designed to identify Omicron (34). However, the melting point temperature of the correct mutation site should be screened. Li et al. developed a triple allele-specific qRT-PCR assay for rapid differentiation of the Omicron mutant and Omicron recombinant mutants (16). The principle was to design specific probes and primers for the specific mutation sites in the Spike protein and NSP region of Omicron BA.1 and BA.2 mutant strains as well as for XD and XE recombinant strains. Primers included prototype and mutant sequences. It employed changes in Cp values between prototype and mutant alleles caused the mismatch effect of the primers. However, the assay was open to incorrect result interpretation because of the intra-/inter-assay Cp variation between the prototype allele- and mutated allele-targeted reaction caused by insufficient specificity and The LoD of the assay was at least 3,060 copies/mL. Chung et al. provided an open-source PCR for surveillance of the spread of B.1.1.7, B.1.351, P.1, and B.1.617.2 variants, and the LoD of the assay was rarely 3,000 copies/mL (19). Therefore, the specificity and sensitivity of the multiplex PCR method need to be improved. Our study is based on qRT-PCR and a novel probe for higher specificity (100%) and sensitivity (250 copies/mL). This probe can also be used with conventional PCR detection instruments (such as the ABI 7500), which are common in disease control centers and hospitals, and improves the accuracy and convenience of mutation screening. There are currently several small molecule drugs (such as ritonavir, nirmatrelvir, and ensitrelvir) that are efficacious in treating COVID-19, but multiple drug-resistant mutations are likely to influence therapeutic effectiveness (35-37). This multiple SNP detection system can therefore be used to monitor subtypes of small molecule drug resistance in the future.
There are some limitations to this study that should be noted. This study was initiated and finished in the midst of the prevalence of the SARS-CoV-2 variants described above, we haven’t been able to study the most recently appeared variants. Nevertheless, it is not difficult to generate new DQ probes against new mutations. Besides, due to lack of Omicron BA.3 samples during the study period, this variant was only tested using a plasmid containing the targeted fragment.
Conclusions
Our study demonstrates that the novel DQ-labeled probe utilized in a multiplex qRT-PCR assay can efficiently identify SARS-CoV-2 variants in clinical samples with greater specificity and sensitivity than TaqMan® probes and TaqMan® MGB probes. Furthermore, the unique DQ-labeled probe can be used to detect SNP. Based on this approach, more DQ-labeled probes can be designed to detect newly discovered SARS-CoV-2 variants, such as JN.1, as well as to detect additional viruses with significant variability and drug resistance.
Acknowledgments
We thank all the participants in this study.
Footnote
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://jtd.amegroups.com/article/view/10.21037/jtd-24-853/rc
Data Sharing Statement: Available at https://jtd.amegroups.com/article/view/10.21037/jtd-24-853/dss
Peer Review File: Available at https://jtd.amegroups.com/article/view/10.21037/jtd-24-853/prf
Funding: This work was supported by
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://jtd.amegroups.com/article/view/10.21037/jtd-24-853/coif). J.Y. and Yong Liu are employed by Kingmed Virology Diagnostic and Translational Center, Guangzhou Kingmed Center for Clinical Laboratory Co., Ltd., Guangzhou, China. H.L., W.L., G.M., X.Z. are employed by Zhuhai Huirui Biotechnology Co., Ltd. The other authors have no conflicts of interest to declare.
Ethical Statement:
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Dejnirattisai W, Huo J, Zhou D, et al. SARS-CoV-2 Omicron-B.1.1.529 leads to widespread escape from neutralizing antibody responses. Cell 2022;185:467-484.e15. [Crossref] [PubMed]
- Farooqi T, Malik JA, Mulla AH, et al. An overview of SARS-COV-2 epidemiology, mutant variants, vaccines, and management strategies. J Infect Public Health 2021;14:1299-312. [Crossref] [PubMed]
- Mistry P, Barmania F, Mellet J, et al. SARS-CoV-2 Variants, Vaccines, and Host Immunity. Front Immunol 2021;12:809244. [Crossref] [PubMed]
- Kumar S, Thambiraja TS, Karuppanan K, et al. Omicron and Delta variant of SARS-CoV-2: A comparative computational study of spike protein. J Med Virol 2022;94:1641-9. [Crossref] [PubMed]
- Desingu PA, Nagarajan K, Dhama K. Emergence of Omicron third lineage BA.3 and its importance. J Med Virol 2022;94:1808-10. [Crossref] [PubMed]
- Chatterjee S, Bhattacharya M, Nag S, et al. A Detailed Overview of SARS-CoV-2 Omicron: Its Sub-Variants, Mutations and Pathophysiology, Clinical Characteristics, Immunological Landscape, Immune Escape, and Therapies. Viruses 2023;15:167. [Crossref] [PubMed]
- Tallei TE, Alhumaid S, AlMusa Z, et al. Update on the omicron sub-variants BA.4 and BA.5. Rev Med Virol 2023;33:e2391. [Crossref] [PubMed]
- Beheshti Namdar A, Keikha M BA.. 2.12.1 is a new omicron offshoot that is a highly contagious but not severe disease. Ann Med Surg (Lond) 2022;79:104034. [Crossref] [PubMed]
- Shrestha LB, Foster C, Rawlinson W, et al. Evolution of the SARS-CoV-2 omicron variants BA.1 to BA.5: Implications for immune escape and transmission. Rev Med Virol 2022;32:e2381. [Crossref] [PubMed]
- Zhou Y, Zhi H, Teng Y. The outbreak of SARS-CoV-2 Omicron lineages, immune escape, and vaccine effectivity. J Med Virol 2023;95:e28138. [Crossref] [PubMed]
- McLean G, Kamil J, Lee B, et al. The Impact of Evolving SARS-CoV-2 Mutations and Variants on COVID-19 Vaccines. mBio 2022;13:e0297921. [Crossref] [PubMed]
- Girma A. The Many Mutations of the COVID-19 Variant: Current Perspectives on EG.5/Eris. Environ Health Insights 2023;17:11786302231217805. [Crossref] [PubMed]
- Fan H, Qin S, Cui Y. Emergence and Characterization of the SARS-CoV-2 JN.1 Variant: Global Prevalence and Implications for Public Health. Zoonoses 2024; [Crossref]
- Banada P, Green R, Banik S, et al. A Simple Reverse Transcriptase PCR Melting-Temperature Assay To Rapidly Screen for Widely Circulating SARS-CoV-2 Variants. J Clin Microbiol 2021;59:e0084521. [Crossref] [PubMed]
- Wang H, Miller JA, Verghese M, et al. Multiplex SARS-CoV-2 Genotyping Reverse Transcriptase PCR for Population-Level Variant Screening and Epidemiologic Surveillance. J Clin Microbiol 2021;59:e0085921. [Crossref] [PubMed]
- Li J, Gao Z, Chen J, et al. Development of a panel of three multiplex allele-specific qRT-PCR assays for quick differentiation of recombinant variants and Omicron subvariants of SARS-CoV-2. Front Cell Infect Microbiol 2022;12:953027. [Crossref] [PubMed]
- Stanhope BJ, Peterson B, Knight B, et al. Development, testing and validation of a SARS-CoV-2 multiplex panel for detection of the five major variants of concern on a portable PCR platform. Front Public Health 2022;10:1042647. [Crossref] [PubMed]
- Yeung PS, Wang H, Sibai M, et al. Evaluation of a Rapid and Accessible Reverse Transcription-Quantitative PCR Approach for SARS-CoV-2 Variant of Concern Identification. J Clin Microbiol 2022;60:e0017822. [Crossref] [PubMed]
- Chung HY, Jian MJ, Chang CK, et al. Emergency SARS-CoV-2 Variants of Concern: Novel Multiplex Real-Time RT-PCR Assay for Rapid Detection and Surveillance. Microbiol Spectr 2022;10:e0251321. [Crossref] [PubMed]
- Yao Y, Nellåker C, Karlsson H. Evaluation of minor groove binding probe and Taqman probe PCR assays: Influence of mismatches and template complexity on quantification. Mol Cell Probes 2006;20:311-6. [Crossref] [PubMed]
- CLSI. Molecular Diagnostic Methods for Infectious Diseases. 3rd Edition. 2015.
- Gray ER, Heaney J, Ferns RB, et al. Minor groove binder modification of widely used TaqMan hydrolysis probe for detection of dengue virus reduces risk of false-negative real-time PCR results for serotype 4. J Virol Methods 2019;268:17-23. [Crossref] [PubMed]
- Zhou B, Yang G, Hu Z, et al. Development of a Real-Time Quantitative PCR Based on a TaqMan-MGB Probe for the Rapid Detection of Theileria haneyi. Microorganisms 2023;11:2633. [Crossref] [PubMed]
- Jiang W, Ji W, Zhang Y, et al. An Update on Detection Technologies for SARS-CoV-2 Variants of Concern. Viruses 2022;14:2324. [Crossref] [PubMed]
- Crossley BM, Bai J, Glaser A, et al. Guidelines for Sanger sequencing and molecular assay monitoring. J Vet Diagn Invest 2020;32:767-75. [Crossref] [PubMed]
- Mayuramart O, Nimsamer P, Rattanaburi S, et al. Detection of severe acute respiratory syndrome coronavirus 2 and influenza viruses based on CRISPR-Cas12a. Exp Biol Med (Maywood) 2021;246:400-5. [Crossref] [PubMed]
- Xiong D, Dai W, Gong J, et al. Rapid detection of SARS-CoV-2 with CRISPR-Cas12a. PLoS Biol 2020;18:e3000978. [Crossref] [PubMed]
- He C, Lin C, Mo G, et al. Rapid and accurate detection of SARS-CoV-2 mutations using a Cas12a-based sensing platform. Biosens Bioelectron 2022;198:113857. [Crossref] [PubMed]
- Selvam K, Najib MA, Khalid MF, et al. RT-LAMP CRISPR-Cas12/13-Based SARS-CoV-2 Detection Methods. Diagnostics (Basel) 2021;11:1646. [Crossref] [PubMed]
- Kostyusheva A, Brezgin S, Babin Y, et al. CRISPR-Cas systems for diagnosing infectious diseases. Methods 2022;203:431-46. [Crossref] [PubMed]
- Hillary VE, Ignacimuthu S, Ceasar SA. Potential of CRISPR/Cas system in the diagnosis of COVID-19 infection. Expert Rev Mol Diagn 2021;21:1179-89. [Crossref] [PubMed]
- Park KJ, Lee W, Chun S, et al. Essential Elements for Establishing Clinical Next-generation Sequencing Testing. Lab Med Online 2019;9:37-44.
- Imaizumi Y, Ishige T, Fujikawa T, et al. Development of multiplex S-gene-targeted RT-PCR for rapid identification of SARS-CoV-2 variants by extended S-gene target failure. Clin Chim Acta 2022;536:6-11. [Crossref] [PubMed]
- Sit BHM, Po KHL, Cheung YY, et al. Detection of SARS-CoV-2 VOC-Omicron using commercial sample-to-answer real-time RT-PCR platforms and melting curve-based SNP assays. J Clin Virol Plus 2022;2:100091. [Crossref] [PubMed]
- Ip JD, Wing-Ho Chu A, Chan WM, et al. Global prevalence of SARS-CoV-2 3CL protease mutations associated with nirmatrelvir or ensitrelvir resistance. EBioMedicine 2023;91:104559. [Crossref] [PubMed]
- Kiso M, Yamayoshi S, Iida S, et al. In vitro and in vivo characterization of SARS-CoV-2 resistance to ensitrelvir. Nat Commun 2023;14:4231. [Crossref] [PubMed]
- Jochmans D, Liu C, Donckers K, et al. The Substitutions L50F, E166A, and L167F in SARS-CoV-2 3CLpro Are Selected by a Protease Inhibitor In Vitro and Confer Resistance To Nirmatrelvir. mBio 2023;14:e0281522. [Crossref] [PubMed]

